Help with a simple script in PERL

[codecatcher]

sounds like homework

[Richard Finney]

What does your first draft look like?

[Phoenix_ICE]

It sounds easy. But I really have no idea about the score! How to calculate the score?
Which one is the most important, and which one is the second, of your 3 limitations

[Bukowski]

Perl is not an acronym and therefore never capitalised. Show some working, or try your luck on stackoverflow.com.

[rdeborja]

A quick starting point

Here's a starting point for you. I copied the 23mer you provided 3 times with a slight modification to the first occurrence.

=== script.pl ======

#!/usr/bin/env perl
use Data::Dumper;

my $sequence = 'ACGATCTTTGCCCCGACGTGATCGAGGTTTTTTTTTTTTTTCAGAGACCGAGATACGATCCCCCGACGTGATCGAGGACGATCCCCCGACGTGATCGAGG';
my @sequences = $sequence =~ /.{21}GG/g;
print Dumper(\@sequences);

__END__

=== output =======
$ perl script.pl
$VAR1 = [
'TCTTTGCCCCGACGTGATCGAGG',
'ACGATCCCCCGACGTGATCGAGG',
'ACGATCCCCCGACGTGATCGAGG'
];

[GenoMax]

@rdeborj: Please enclose your code in [CODE_] code here [/_CODE]. Remove the underscores when you use the tags.

[codecatcher]

Thanks rdeborja and GenoMax for the comments. I will try it out and see if I can get it working with that.
Phoenix ICE I assume they are all equal parameters that need to be parsed if possible

[sklages]

The above

/.{21}GG/g

won't catch overlapping 23mers. Just keep that in mind. E.g.:

$sequence = 'ACGATCTTTGCCCCGACGTGATCGAGGTTTGGTTGGTTTTTTTTTCAGAGACCGAGATACGATCCCCCGACGTGATCGAGGACGATCCCCCGACGTGATCGAGG';