Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • What is a kart file?

    In trying to download files from SRA, I was directed to use part of the sratoolkit called "prefetch". There I came across the term "kart file":

    SRA Tools. Contribute to ncbi/sra-tools development by creating an account on GitHub.


    What is a kart file?

    Thanks.

    Eric

  • #2
    If you have SRA accession numbers (and all you are interested in is downloading fastq data) then use this procedure: http://seqanswers.com/forums/showpos...36&postcount=7

    Comment


    • #3
      Hi GenoMax,

      Thanks very much for the suggestion. I followed the instructions and they seemed to work in that the little snippet of test code worked as it should:

      Code:
      efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$ ./fastq-dump -X 5 -Z SRR390728
      Read 5 spots for SRR390728
      Written 5 spots for SRR390728
      @SRR390728.1 1 length=72
      CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC
      +SRR390728.1 1 length=72
      ;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96&&&&(
      @SRR390728.2 2 length=72
      AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT
      +SRR390728.2 2 length=72
      ;;;;;;;;;;;;;;;;;4;;;;3;393.1+4&&5&&;;;;;;;;;;;;;;;;;;;;;<9;<;;;;;464262
      @SRR390728.3 3 length=72
      CCAGCCTGGCCAACAGAGTGTTACCCCGTTTTTACTTATTTATTATTATTATTTTGAGACAGAGCATTGGTC
      +SRR390728.3 3 length=72
      -;;;8;;;;;;;,*;;';-4,44;,:&,1,4'./&19;;;;;;669;;99;;;;;-;3;2;0;+;7442&2/
      @SRR390728.4 4 length=72
      ATAAAATCAGGGGTGTTGGAGATGGGATGCCTATTTCTGCACACCTTGGCCTCCCAAATTGCTGGGATTACA
      +SRR390728.4 4 length=72
      1;;;;;;,;;4;3;38;8%&,,;)*;1;;,)/%4+,;1;;);;;;;;;4;(;1;;;;24;;;;41-444//0
      @SRR390728.5 5 length=72
      TTAAGAAATTTTTGCTCAAACCATGCCCTAAAGGGTTCTGTAATAAATAGGGCTGGGAAAACTGGCAAGCCA
      +SRR390728.5 5 length=72
      ;;;;;;;;;;;;;;;;;;;;;;;;;;;;;9445552;;;;;;;;;;;;;;;;;;;;;;;;;;;;;;446662
      However, when I went to try to download something real, it didn't work:

      Code:
      efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$ ./fastq-dump -B SRA044886
      2015-03-11T19:34:36 fastq-dump.2.4.5 err: item not found while constructing within virtual database module - the path 'SRA044886' cannot be opened as database or table
      efoss@gizmod31:~/source_codes/sratoolkit.2.4.5-2-ubuntu64/bin$
      This was an attempt to download fastq files that had been acquired with SOLiD, but I wanted them to download in base space. Does anyone have a suggestion to fix this? I Googled the error and found a suggestion to restore defaults with "vdv-config --restore-defaults":

      It seems that the prefetch routine is not working properly, as none of the toolkit tools are properly fetching runs by accession: $ fastq-dump -X 5 -Z SRR390728 2015-02-03T17:07:21 fastq-dump.2.4.3...


      but this didn't help.

      Thanks.

      Eric

      Comment


      • #4
        You need to use abi-dump for SOLiD data.

        That said the accession number you posted above is not working with abi-dump. It is not uncommon to find accession numbers that do not work. Emailing sra-techsupport can be useful in these cases.

        You can also find this dataset at ENA: http://www.ebi.ac.uk/ena/data/view/SRA044886 The files say they are "fastq" but you will need to check what format they are in.

        Comment


        • #5
          Hi Genomax,

          Thanks very much. I really appreciate the help.

          Eric

          Comment


          • #6
            efoss asked 'What is a kart file? '

            efoss asked 'What is a kart file? '

            Does anyone have the answer and can you explain the format of the file and what information it contains?

            Comment


            • #7
              Cart (.kart) files are referenced in this document http://www.ncbi.nlm.nih.gov/books/NB...efetch_command I don't see a description of the file format.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Best Practices for Single-Cell Sequencing Analysis
                by seqadmin



                While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                06-06-2024, 07:15 AM
              • seqadmin
                Latest Developments in Precision Medicine
                by seqadmin



                Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                Somatic Genomics
                “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                05-24-2024, 01:16 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 06-07-2024, 06:58 AM
              0 responses
              179 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-06-2024, 08:18 AM
              0 responses
              227 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-06-2024, 08:04 AM
              0 responses
              184 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-03-2024, 06:55 AM
              0 responses
              18 views
              0 likes
              Last Post seqadmin  
              Working...
              X