Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • diego diaz
    Member
    • Oct 2013
    • 62

    Error in htseq-count

    Hi all,

    I am having a problem when I try to run htseq-count. This is the sentence that I am using:

    htseq-count -f bam -s no -i ID -t window mybam.bam genes.tab.gff3 > counts_file.count

    This is the error:

    77000 GFF lines processed.
    Error occured when reading beginning of SAM/BAM file.
    object of type 'NoneType' has no len()
    [Exception type: TypeError, raised in _HTSeq.pyx:771]



    And this is my bam header:

    @HD VN:1.0
    @SQ SN:chr1 LN:197195432 AS:mm9 SP:Mus musculus
    @SQ SN:chr2 LN:181748087 AS:mm9 SP:Mus musculus
    @SQ SN:chr3 LN:159599783 AS:mm9 SP:Mus musculus
    @SQ SN:chr4 LN:155630120 AS:mm9 SP:Mus musculus
    @SQ SN:chr5 LN:152537259 AS:mm9 SP:Mus musculus
    @SQ SN:chr6 LN:149517037 AS:mm9 SP:Mus musculus
    @SQ SN:chr7 LN:152524553 AS:mm9 SP:Mus musculus
    @SQ SN:chr8 LN:131738871 AS:mm9 SP:Mus musculus
    @SQ SN:chr9 LN:124076172 AS:mm9 SP:Mus musculus
    @SQ SN:chr10 LN:129993255 AS:mm9 SP:Mus musculus
    @SQ SN:chr11 LN:121843856 AS:mm9 SP:Mus musculus
    @SQ SN:chr12 LN:121257530 AS:mm9 SP:Mus musculus
    @SQ SN:chr13 LN:120284312 AS:mm9 SP:Mus musculus
    @SQ SN:chr14 LN:125194864 AS:mm9 SP:Mus musculus
    @SQ SN:chr15 LN:103494974 AS:mm9 SP:Mus musculus
    @SQ SN:chr16 LN:98319150 AS:mm9 SP:Mus musculus
    @SQ SN:chr17 LN:95272651 AS:mm9 SP:Mus musculus
    @SQ SN:chr18 LN:90772031 AS:mm9 SP:Mus musculus
    @SQ SN:chr19 LN:61342430 AS:mm9 SP:Mus musculus
    @SQ SN:chrM LN:16299 AS:mm9 SP:Mus musculus
    @SQ SN:chrX LN:166650296 AS:mm9 SP:Mus musculus
    @SQ SN:chrY LN:15902555 AS:mm9 SP:Mus musculus
    @RG ID:CNhs13087.11810-124E1.nobarcode SM:11810-124E1 LB:CNhs13087 PU:Heliscope CN:GeNAS DT:2011-05-06 00:00:00 PL:OP-HELISCOPE-CAGE-v4.0
    @PG IDelve VNelve 0.9 CL:/quality_control/development/bin/delve -u 1 -o /tmp/964608.1.all.q/tE0acLw1vu.sam -m /tmp/964608.1.all.q/TaiL4zcI8M/model/CNhs13087.model -t 8 align /tmp/964608.1.all.q/TaiL4zcI8M/temp/CNhs13087_data/delve_seed/output/CNhs13087.2011_05_06_R2_30Q_1100FOV.fc2.ch15.11810-124E1.nobarcode.sam /tmp/964608.1.all.q/TaiL4zcI8M/temp/CNhs13087_data/genome_sequence/output/mm9_undefined_sex_type.fa
    VHE-211910141003-15-998-2-3681 0 chr1 3000762 1 12M1I12M * 0 0 TGTTTTTTCTGTATTCCGTTTTAGT * NM:i:3MD:Z:16T3C3 XP:Z:H<@@~~~~=>=1!-./*(*******
    VHE-211910141003-15-46-2-844 528 chr1 3000859 3 7M1I18M1I4M1I8M1I9M * 0 0 CGGAGCCGCTCTGCTAGCTGTTAGCTGTAGCTATGCGGTCTCCGTGCCGG * NM:i:14 MD:Z:0T2G1G5A14G4T0T3A2A3G2 XP:Z:&%%#%$$!$%%&&&&&&''''''''&!%%&&!&&~~~~~%#~6797++7O
    VHE-211910141003-15-1032-0-2496 0 chr1 3001837 7 2M2D19M * 0 0 CTAGCTGACTCTCTAGACAGC * NM:i:2 MD:Z:2^TG19 XP:Z'))---~~~~=>>~~~~L@F



    I don't know what is wrong. Please can you give me some advice?

    Thanks in advance!
  • reema
    Member
    • Feb 2014
    • 27

    #2
    Hello diego,

    Here the solution http://sourceforge.net/p/htseq/bugs/12/

    Comment

    • diego diaz
      Member
      • Oct 2013
      • 62

      #3
      Thanks reema

      Comment

      • jay2utee
        Junior Member
        • Apr 2015
        • 1

        #4
        Thanks, all, for the pointers, but I'm still unclear as to how to apply the solution that's mentioned in the bug report (which is still tagged as "open").

        I found the three instances of the string that needed correction (per the advice in the report), changed them and recompiled, but I still get the same error.

        -John

        Comment

        • dpryan
          Devon Ryan
          • Jul 2011
          • 3478

          #5
          You might just give featureCounts a try. It should be faster anyway.

          Comment

          Latest Articles

          Collapse

          • mylaser
            Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by mylaser
            Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
            If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
            This guide explains everything you need to know about...
            Today, 01:13 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM
          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            07-08-2026, 05:17 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, 07-09-2026, 10:04 AM
          0 responses
          17 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-08-2026, 10:08 AM
          0 responses
          10 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          22 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Working...