Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adding count number at the end of header in a fasta file

    Hi there. I would like to add count number at the end of the head, from this:

    >ECOLI
    ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
    >ECOLI
    ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
    >ECOLI
    ACGTGTGCAACCTGCACTGTGCTAGCACGACACAACGTG
    .
    .
    .
    >ECOLI
    ATGTGTACGTAGCTAGCTAGCATCGATCTGCTAGCATGC
    >ECOLI
    GTCGATGCTGCTCGATCGATCGATCGTACGATCGATGATC
    become this:

    >ECOLI|00000001
    ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
    >ECOLI|00000002
    ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
    >ECOLI|00000003
    ACGTGTGCAACCTGCACTGTGCTAGCACGACACAACGTG
    .
    .
    .
    >ECOLI|00000099
    ATGTGTACGTAGCTAGCTAGCATCGATCTGCTAGCATGC
    >ECOLI|00000199
    GTCGATGCTGCTCGATCGATCGATCGTACGATCGATGATC

    Can anyone guide me how to add the count number like the above?

    Thank you very much.

  • #2
    You could use bioawk for this:

    Code:
    bioawk -c fastx '{print ">" $name sprintf("|%05d", NR) "\n" $seq}' test.fa
    
    >ECOLI|00001
    ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
    >ECOLI|00002
    ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
    >ECOLI|00003
    ACGTGTGCAACCTGCACTGTGCTAGCACGACACAACGTG
    ...

    Comment


    • #3
      Code:
      perl -i.bak -pe 'BEGIN{$N="00000001"}next unless /^>/;s/(>\S+)/$1|$N/;$N++' t.fa
      Changes the sequences in t.fa from:

      >ECOLI
      ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
      >ECOLI
      ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
      >ECOLI
      ACGTGTGCAACCTGCACTGTGCTAGCACGACACAACGTG


      to

      >ECOLI|00000001
      ACTGCGTAGTCGTACTATGCAACACACGTGTGTATGCT
      >ECOLI|00000002
      ACGTTAGTTTCGCGTAGTCGTATGCTACGATCGTAGCA
      >ECOLI|00000003
      ACGTGTGCAACCTGCACTGTGCTAGCACGACACAACGTG


      It also makes a handy back up file saved as "t.fa.bak" just in case you regret the modifications you've made to the original file.

      --
      Phillip

      Comment


      • #4
        dear all, thanks. it is very useful. :-)

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Exploring the Dynamics of the Tumor Microenvironment
          by seqadmin




          The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
          07-08-2024, 03:19 PM
        • seqadmin
          Exploring Human Diversity Through Large-Scale Omics
          by seqadmin


          In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
          06-25-2024, 06:43 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Today, 06:53 AM
        0 responses
        11 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-10-2024, 07:30 AM
        0 responses
        32 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 09:45 AM
        0 responses
        203 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 07-03-2024, 08:54 AM
        0 responses
        213 views
        0 likes
        Last Post seqadmin  
        Working...
        X