Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Lien
    Member
    • Dec 2009
    • 47

    #1

    defuse segmentation fault

    Hi all,

    I'm using the defuse program to detect gene fusions from RNA-seq data experiments. So far, I have already run it succesfully on 19 samples, but one samples gives me an error. The sequencing and processing of the fastq-files was similar for all samples, so I don't understand what is causing the error and how to solve it. Also, defuse runs on a cluster, so memory should not be an issue.

    Failure for defuse command:
    /gmap/2014-12-25/bin/gmap -D /defuse/data/gmap -d chr12 -f psl /defuse_out/GC011104_new_make_pairs/jobs/breakpoints.split.001.fa > /defuse_out/GC011104_new_make_pairs/jobs/breakpoints.split.001.fa.genome.12.psl.tmp
    Reason:
    Job command with nonzero return code
    Return codes: 139
    Job output:
    Running on cnpew06.uz.kuleuven.ac.be
    GMAP version 2014-12-25 called with args: /gmap/2014-12-25/bin/gmap -D /defuse/data/gmap -d chr12 -f psl /defuse_out/GC011104_new_make_pairs/jobs/breakpoints.split.001.fa
    Checking compiler assumptions for popcnt: 6B8B4567 __builtin_clz=1 __builtin_ctz=0 __builtin_popcount=17
    Checking compiler assumptions for SSE2: 6B8B4567 327B23C6 xor=59F066A1
    Finished checking compiler assumptions
    Note: >1 sequence detected, so index files are being memory mapped.
    GMAP can run slowly at first while the computer starts to accumulate
    pages from the hard disk into its cache. To copy index files into RAM
    instead of memory mapping, use -B 3, -B 4, or -B 5, if you have enough RAM.
    For more speed, also try multiple threads (-t <int>), if you have multiple processors or cores.
    Pre-loading compressed genome (oligos)...,..,...,...,...,...,...,...done (50,194,464 bytes, 12255 pages, 4.24 sec)
    Pre-loading compressed genome (bits)...,..,...,...,...,...,...,...done (50,194,512 bytes, 12255 pages, 3.92 sec)
    Looking for index files in directory /defuse/data/gmap/chr12
    Pointers file is chr12.ref153offsets64meta
    Offsets file is chr12.ref153offsets64strm
    Positions file is chr12.ref153positions
    Offsets compression type: bitpack64
    Allocating memory for ref offset pointers, kmer 15, interval 3...done (134,217,744 bytes, 16.43 sec)
    Allocating memory for ref offsets, kmer 15, interval 3...done (165,223,408 bytes, 15.29 sec)
    Pre-loading ref positions, kmer 15, interval 3.......................................................................done (173,974,980 bytes, 42475 pages, 8.78 sec)
    No paths found for 28672
    No paths found for 18047
    No paths found for 9575
    No paths found for 4406
    No paths found for 4399
    No paths found for 17815
    Exception: SIGSEGV--segmentation violation raised at gmap.c:4066
    /defuse_out/GC011104_new_make_pairs/log/defuse.46.sh: line 6: 9384 Segmentation fault /gmap/2014-12-25/bin/gmap -D /defuse/data/gmap -d chr12 -f psl /defuse_out/GC011104_new_make_pairs/jobs/breakpoints.split.001.fa > /defuse_out/GC011104_new_make_pairs/jobs/breakpoints.split.001.fa.genome.12.psl.tmp

    real 2m58.901s
    user 2m7.904s
    sys 0m2.226s


    any suggestions are most welcome.

    Thanks,
    Lien
  • kmcallenberg
    Bioinformatics Scientist, UPMC
    • Nov 2008
    • 4

    #2
    Hello, similarly for me, after running deFuse successfully on a large number of samples, I am reproducibly seeing this same behavior for one sample as well. The output suggests looking at ipcs -m, but this appears to be empty.

    I will contact the authors of deFuse with this issue and post back here if they have any suggestions.

    Here is my output:

    Signal received: SIGSEGV
    Calling Access_emergency_cleanup
    Removed existing memory for shmid 3964929
    Removed existing memory for shmid 3932160

    You may want to run 'ipcs -m' to see if any shared memory segments are still in use
    You can remove a shared memory segment manually by doing 'ipcrm -m <shmid>'

    Problem sequence: 114725 (351 bp)

    real 5m31.585s
    user 5m23.275s
    sys 0m6.870s
    Return codes: 9
    Commands failed after 333 seconds

    Comment

    • anandksrao
      Junior Member
      • Jun 2011
      • 9

      #3
      Could you resolve your problem?

      gmap --cmdline=ATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATGCCAGGTTCTTCATACCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAATATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAATTAACTTATTATTAGCACAATTAGCTATTAATGATATTTTTTGTAGC,CCCTAAGCCAACGACCTATCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCTAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCTTCATGTCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAACATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAGTTAACTTATTATTAGCACAATTAGCTATTAATGAT -S
      GMAP version 2015-06-23 called with args: gmap --cmdline=ATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATGCCAGGTTCTTCATACCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAATATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAATTAACTTATTATTAGCACAATTAGCTATTAATGATATTTTTTGTAGC,CCCTAAGCCAACGACCTATCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCTAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCTTCATGTCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAACATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAGTTAACTTATTATTAGCACAATTAGCTATTAATGAT -S
      Checking compiler assumptions for popcnt: 000041A7 __builtin_clz=17 __builtin_ctz=0 _mm_popcnt_u32=7 __builtin_popcount=7
      Checking compiler assumptions for SSE2: 000041A7 10D63AF1 xor=10D67B56
      Checking compiler assumptions for SSE4.1: -89 -15 max=241 => compiler zero extends
      Finished checking compiler assumptions
      Starting alignment
      Signal received: SIGSEGV
      Calling Access_emergency_cleanup
      Unable to retrieve queryseq for request


      When I manually and arbitrarily change the query CDS sequence, by shortening it, it works and gives an alignment. Just an example below:
      DCook04-2:RGEC anand$ gmap --cmdline=ATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATGCCAGGTTCTTCATACCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAATATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAATTAACTTATTATTAGCACAATTAGCTATTAATGATATTTTTTGTAGC,CCCTAAGCCAACGACCTATCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCTAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCTTCATGTCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGAC -S
      GMAP version 2015-06-23 called with args: gmap --cmdline=ATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATACCAGGTCCTTCATGCCAGGTCCTTCATGCCAGGTTCTTCATACCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGACCTCAAGAATATTTATGCCATACAGGGGGCTATTCTCACTTTATCTAATGAAATTAACTTATTATTAGCACAATTAGCTATTAATGATATTTTTTGTAGC,CCCTAAGCCAACGACCTATCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCCTAAGCTAACGACCTCTCAGGTCCCTAAGCCAACGACCTCTCAGGTCCTTCATGTCAGGTCCTTCATCGCGACCTCACCAGGTCTATCAACGACCTCCTCAAATTACAGGTCTTTCAACGAC -S
      Checking compiler assumptions for popcnt: 000041A7 __builtin_clz=17 __builtin_ctz=0 _mm_popcnt_u32=7 __builtin_popcount=7
      Checking compiler assumptions for SSE2: 000041A7 10D63AF1 xor=10D67B56
      Checking compiler assumptions for SSE4.1: -89 -15 max=241 => compiler zero extends
      Finished checking compiler assumptions
      Starting alignment
      >NO_HEADER
      Paths (3):
      Path 1: query 116..196 (81 bp) => genome 89..183 (95 bp)
      cDNA direction: sense
      Genomic pos: 89..183 (+ strand)
      Number of exons: 2
      Coverage: 41.3 (query length: 196 bp)
      Trimmed coverage: 41.3 (trimmed length: 196 bp, trimmed region: 1..196)
      Percent identity: 98.8 (80 matches, 1 mismatches, 0 indels, 0 unknowns)
      Translation: 116..196 (27 aa)
      Amino acid changes: A5V [127]

      Path 2: query 116..141 (26 bp) => genome 47..72 (26 bp)
      cDNA direction: indeterminate
      Genomic pos: 47..72 (+ strand)
      Number of exons: 1
      Coverage: 13.3 (query length: 196 bp)
      Trimmed coverage: 13.3 (trimmed length: 196 bp, trimmed region: 1..196)
      Percent identity: 96.2 (25 matches, 1 mismatches, 0 indels, 0 unknowns)
      Amino acid changes:

      Path 3: query 116..141 (26 bp) => genome 5..30 (26 bp)
      cDNA direction: indeterminate
      Genomic pos: 5..30 (+ strand)
      Number of exons: 1
      Coverage: 13.3 (query length: 196 bp)
      Trimmed coverage: 13.3 (trimmed length: 196 bp, trimmed region: 1..196)
      Percent identity: 92.3 (24 matches, 2 mismatches, 0 indels, 0 unknowns)
      Amino acid changes:

      Alignments:
      Alignment for path 1:

      89-105 (116-132) 94% -> ...14...
      120-183 (133-196) 100%

      Alignment for path 2:

      47-72 (116-141) 96%

      Alignment for path 3:

      5-30 (116-141) 92%

      Processed 1 queries in 0.03 seconds (33.33 queries/sec)

      So WHY am I getting this error, and how can I resolve it?

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        07-31-2026, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 10:35 AM
      0 responses
      6 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-06-2026, 07:41 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-03-2026, 10:13 AM
      0 responses
      41 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-31-2026, 02:55 AM
      0 responses
      47 views
      0 reactions
      Last Post SEQadmin2  
      Working...