-
My guess is the sequence has been reverse complemented, and that's why you can't find it. As dpryan suggests, try searching by the read name instead. -
Try grepping for the read name, that's less error prone:
Code:zgrep -A 3 "HWI:stuff" file.fastq.gz
Leave a comment:
-
why the read sequence from IGV can't be found in fastq?
I found a strange read pair from IGV, so i want to extract the original information about the read pair.
I use " zcat file.fastq.gz | grep -B 3 "TCTCAAAAAGCACATGGATTCTACTCCTGATTTCTCCAAGGATCTACATATGATCAAAACATATCTTTACCAGATTCTCCGTGGAATTGCGTATTGCCACTCTCATAGGGTTCTCCATCGTGATC"
The strange thing is i can't find it in original fq file.
-
The field of immunogenetics explores how genetic variations influence immune responses and susceptibility to disease. In a recent SEQanswers webinar, Oscar Rodriguez, Ph.D., Postdoctoral Researcher at the University of Louisville, and Ruben Martínez Barricarte, Ph.D., Assistant Professor of Medicine at Vanderbilt University, shared recent advancements in immunogenetics. This article discusses their research on genetic variation in antibody loci, antibody production processes,...11-06-2024, 07:24 PM -
Next-generation sequencing (NGS) and quantitative polymerase chain reaction (qPCR) are essential techniques for investigating the genome, transcriptome, and epigenome. In many cases, choosing the appropriate technique is straightforward, but in others, it can be more challenging to determine the most effective option. A simple distinction is that smaller, more focused projects are typically better suited for qPCR, while larger, more complex datasets benefit from NGS. However,...10-18-2024, 07:11 AM
Leave a comment: