Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • why the read sequence from IGV can't be found in fastq?

    I found a strange read pair from IGV, so i want to extract the original information about the read pair.
    I use " zcat file.fastq.gz | grep -B 3 "TCTCAAAAAGCACATGGATTCTACTCCTGATTTCTCCAAGGATCTACATATGATCAAAACATATCTTTACCAGATTCTCCGTGGAATTGCGTATTGCCACTCTCATAGGGTTCTCCATCGTGATC"
    The strange thing is i can't find it in original fq file.

  • #2
    Try grepping for the read name, that's less error prone:

    Code:
    zgrep -A 3 "HWI:stuff" file.fastq.gz

    Comment


    • #3
      My guess is the sequence has been reverse complemented, and that's why you can't find it. As dpryan suggests, try searching by the read name instead.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Exploring the Dynamics of the Tumor Microenvironment
        by seqadmin




        The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
        07-08-2024, 03:19 PM
      • seqadmin
        Exploring Human Diversity Through Large-Scale Omics
        by seqadmin


        In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
        06-25-2024, 06:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 07-19-2024, 07:20 AM
      0 responses
      37 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-16-2024, 05:49 AM
      0 responses
      47 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-15-2024, 06:53 AM
      0 responses
      57 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-10-2024, 07:30 AM
      0 responses
      43 views
      0 likes
      Last Post seqadmin  
      Working...
      X