Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • maubp
    replied
    Species restriction can be down with qblast setting entrez_query (or BLAST+ using -remote) and an Entrez [orgn] query, e.g. http://news.open-bio.org/news/2009/0...nfo-biopython/

    As to your script, try adding a bit more debugging, e.g.

    Code:
        data = result_handle.read()
        print("Got back: %r" % data)
        save_file.write(data)

    Leave a comment:


  • queueing
    started a topic automated remote blasting issue

    automated remote blasting issue

    Hi everyone,

    I'm trying to remotely blast about 70 200-nt sequences using Biopython.
    I've been trying for hours to figure out why the following Python script won't work.
    I can get it to work for a read file that contains just one fasta using SeqIO.read, but when I try to switch to SeqIO.parse, I don't get anything in the .xml save file that I create.
    Any ideas?

    As a side note, if anyone knows the option syntax for excluding organisms from the results (as is possible when using the ncbi website, please let me know).

    Thanks very much for any help.

    Matt

    from Bio.Blast import NCBIWWW
    from Bio import SeqIO
    import tkinter.filedialog as tkfd
    in_file=tkfd.askopenfilename()
    record = SeqIO.parse(in_file, format="fasta")
    out_file = tkfd.asksaveasfilename()
    save_file = open(out_file, "w")
    for rec in record:
    ....print(rec)
    ....result_handle = NCBIWWW.qblast("blastn", "nt", rec.format("fasta"))
    ....save_file.write(result_handle.read())
    ....result_handle.close()
    else:
    ....save_file.close()

    This is the content of the in_file that I'm using as a test file (the line formatting of my file is set at 80 char, which might have been lost below):
    >165613
    TAACTGCAGTGTTTTGTGTCGAGCCTTTTTTGTGCCTTTTTTATAAAGGCATAACGTTATATTTAATTGAAGAGTTTGAT
    TCTGGCTCAGATTGAACGCTAGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCGCGGGGAGCTTGCTCCCTGGCGGC
    GAGTGGCGGACGGGTGAGTAATGCGTAGGAATCTACCTTG
    >165875
    GGGATCTTCGGACCTCGTGCTATAAGATGAGCCTACGTCGGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACG
    ATCCGTAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGG
    GAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCC
    Last edited by queueing; 04-29-2015, 06:12 AM. Reason: fixed indentation

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
54 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
43 views
0 likes
Last Post seqadmin  
Working...
X