Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • automated remote blasting issue

    Hi everyone,

    I'm trying to remotely blast about 70 200-nt sequences using Biopython.
    I've been trying for hours to figure out why the following Python script won't work.
    I can get it to work for a read file that contains just one fasta using SeqIO.read, but when I try to switch to SeqIO.parse, I don't get anything in the .xml save file that I create.
    Any ideas?

    As a side note, if anyone knows the option syntax for excluding organisms from the results (as is possible when using the ncbi website, please let me know).

    Thanks very much for any help.

    Matt

    from Bio.Blast import NCBIWWW
    from Bio import SeqIO
    import tkinter.filedialog as tkfd
    in_file=tkfd.askopenfilename()
    record = SeqIO.parse(in_file, format="fasta")
    out_file = tkfd.asksaveasfilename()
    save_file = open(out_file, "w")
    for rec in record:
    ....print(rec)
    ....result_handle = NCBIWWW.qblast("blastn", "nt", rec.format("fasta"))
    ....save_file.write(result_handle.read())
    ....result_handle.close()
    else:
    ....save_file.close()

    This is the content of the in_file that I'm using as a test file (the line formatting of my file is set at 80 char, which might have been lost below):
    >165613
    TAACTGCAGTGTTTTGTGTCGAGCCTTTTTTGTGCCTTTTTTATAAAGGCATAACGTTATATTTAATTGAAGAGTTTGAT
    TCTGGCTCAGATTGAACGCTAGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCGCGGGGAGCTTGCTCCCTGGCGGC
    GAGTGGCGGACGGGTGAGTAATGCGTAGGAATCTACCTTG
    >165875
    GGGATCTTCGGACCTCGTGCTATAAGATGAGCCTACGTCGGATTAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACG
    ATCCGTAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGG
    GAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCC
    Last edited by queueing; 04-29-2015, 06:12 AM. Reason: fixed indentation

  • #2
    Species restriction can be down with qblast setting entrez_query (or BLAST+ using -remote) and an Entrez [orgn] query, e.g. http://news.open-bio.org/news/2009/0...nfo-biopython/

    As to your script, try adding a bit more debugging, e.g.

    Code:
        data = result_handle.read()
        print("Got back: %r" % data)
        save_file.write(data)

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    13 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    17 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    43 views
    0 likes
    Last Post seqadmin  
    Working...
    X