Trinity aling and estimate abundance

[lupid]

Hi to all of you, I'm trying to perform aling_and_estimate abundance and it show the following error message

CMD: set -o pipefail && bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/cmeneses/tomas/carpa/trinity_min_1000/Trinity.fasta.bowtie -1 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R1_001_N_a_90.fastq -2 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R2_001_N_a_90.fastq | samtools view -F 4 -S -b -o bowtie.bam -
Encountered a space parsing the quality string for read M01447:53:000000000-A85CC:1:2108:5717:20672 1:N:0:1
If this is a FASTQ file with integer (non-ASCII-encoded) qualities, please
re-run Bowtie with the --integer-quals option. If this is a FASTQ file with
alternate basecall information, please re-run Bowtie with the --fuzzy option.
terminate called after throwing an instance of 'int'
bash: line 1: 42703 Aborted (core dumped) bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/cmeneses/tomas/carpa/trinity_min_1000/Trinity.fasta.bowtie -1 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R1_001_N_a_90.fastq -2 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R2_001_N_a_90.fastq
42704 Done | samtools view -F 4 -S -b -o bowtie.bam -
Error, cmd: set -o pipefail && bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/cmeneses/tomas/carpa/trinity_min_1000/Trinity.fasta.bowtie -1 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R1_001_N_a_90.fastq -2 /home/cmeneses/tomas/carpa/PVeranoPool_S1_L001_R2_001_N_a_90.fastq | samtools view -F 4 -S -b -o bowtie.bam - died with ret: 34304 at /opt/trinityrnaseq-2.0.6/util/align_and_estimate_abundance.pl line 653.

[GenoMax]

Have you inspected the read "M01447:53:000000000-A85CC:1:2108:5717:20672 1:N:0:1"? Can you post the 4 fastq lines for that read?

[lupid]

Here is one of the error message

MD: set -o pipefail && bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/cmeneses/tomas/carpa/trinity_min_1000/Trinity.fasta.bowtie -1 /home/cmeneses/tomas/carpa/PInviernoPool_S2_L001_R1_001r_N_a_q20_150.fastq -2 /home/cmeneses/tomas/carpa/PInviernoPool_S2_L001_R2_001r_N_a_q20_150.fastq | samtools view -F 4 -S -b -o PIr.bowtie.bam -
Too few quality values for read: M01447:54:000000000-A8564:1:1113:13048:8317 1:N:0:2
are you sure this is a FASTQ-int file?
terminate called after throwing an instance of 'int'
bash: line 1: 41224 Aborted (core dumped) bowtie -q --all --best --strata -m 300 --chunkmbs 512 -X 800 -S -p 4 /home/cmeneses/tomas/carpa/trinity_min_1000/Trinity.fasta.bowtie -1 /home/cmeneses/tomas/carpa/PInviernoPool_S2_L001_R1_001r_N_a_q20_150.fastq -2 /home/cmeneses/tomas/carpa/PInviernoPool_S2_L001_R2_001r_N_a_q20_150.fastq
41225 Done | samtools view -F 4 -S -b -o PIr.bowtie.bam -

And here are the read that make reference the error, I cannot see any difference with the others

CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG$
@M01447:54:000000000-A8564:1:1113:21795:8317 1:N:0:2
GAAAGTGTATACTTAATCACTGCACCTAAACTGCTGCGACTCGATGCTTCGGAAAAGGTGGTGGTGCAGTTGTTTGGTT$
+
CCCCCFFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFFFGGGDGGGGDGGGEGFFFGGGGGGGGGGGGGFFGGGGG$
@M01447:54:000000000-A8564:1:1113:25331:8317 1:N:0:2
CCTGGAGATGCTCCGCCACCTTCTCGCGCACAGCCTCCAAGATGGGCATCAGCTTGGACTTGGTCTCCTCCCAGTTGGG$
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG$
@M01447:54:000000000-A8564:1:1113:13048:8317 1:N:0:2
TAGAAAGCTGACTTCTAAAGCAAGGAAATGTTCCTGTACATTATAGGTCTCATAGTCTGCTTCTATGTCTATCGGTGGT$
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTTCTTGGTTTTAGTAACAAAC$
+
CCCCCGGGFFCFGGGFDGGGGGGDDEFGGCFDGGFGFGGGGGGGGGFGGFGFGGGGGG<FA<EGEGGGGCEFFGGEEFG$
@M01447:54:000000000-A8564:1:1113:26398:8315 1:N:0:2
CTCGTTCATCTTTTTCCTCAGTTCTCCAGATTTCACGCTCTGGCGGAACTCCTGGGCTCCCTTCTCCATCTGCTCCCTA$
+

please help

[GenoMax]

Do you really have this in your file (from your example)? Two lines starting with "+"? That is the problem (breaking fastq format).

@M01447:54:000000000-A8564:1:1113:13048:8317 1:N:0:2
TAGAAAGCTGACTTCTAAAGCAAGGAAATGTTCCTGTACATTATAGGTCTCATAGTCTGCTTCTATGTCTATCGGTGGT$
+
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGTTCTTGGTTTTAGTAACAAAC$
+
CCCCCGGGFFCFGGGFDGGGGGGDDEFGGCFDGGFGFGGGGGGGGGFGGFGFGGGGGG<FA<EGEGGGGCEFFGGEEFG$

[lupid]

this files was trimmed in ubuntu, and has been upload in a unix environment, and I don't have not tried with other programs

[GenoMax]

It appears that something messed up the file since you have two header lines that start with a "+" instead of normal fastq format (one header line starting with a "@" and other header line starting with a "+").

[lupid]

And how can I repair that?

[GenoMax]

What program did you use to trim? I would suggest going back and re-trimming (this appears to be MiSeq data, so it should not take long).

[lupid]

I used flexbar, and yes are miSeq, and trim all the "+"??

[GenoMax]

I used flexbar, and yes are miSeq, and trim all the "+"??

Flexbar is new to me (did you use it because you also demultiplexed the data at the same time?). As long as flexbar works correctly it should not be messing up the fastq format in the files. The "+" has a special meaning when paired with a @ header line (http://en.wikipedia.org/wiki/FASTQ_format).

If re-trimming with flexbar results in the same problem then I will suggest that you use BBDuk/trimmomatic for the trimming (demultiplexbyname.sh from BBMap will do demultiplexing, if you need that).