Header Leaderboard Ad

Collapse

Tophat gtf_to_fasta ignoring strand

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat gtf_to_fasta ignoring strand

    Hi all,

    Am I crazy, or does Tophat's gtf_to_fasta utility seem to ignore strand information? Using the hg19 iGenomes release, for example. Transcript NR_024540 is on the minus strand.

    Code:
    585	NR_024540	chr1	-	14361	29370	29370	29370	11	14361,14969,15795,16606,16857,17232,17605,17914,18267,24737,29320,	14829,15038,15947,16765,17055,17368,17742,18061,18366,24891,29370,	0	WASH7P	unk	unk	-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1,
    Now, looking at the sequence in UCSC (first two lines):
    Code:
    >NR_024540.1
    tccggcagagcggaagcggcggcgggagcttccgggagggcggctcgcag
    gcaccatgactcctgtgaggatgcagcactccctggcaggtcagacctat
    Looking at the sequence from the genes.fa file that gtf_to_fasta outputs:
    Code:
    >1 NR_024540 chr1- 14362-14829,14970-15038,15796-15947,16607-16765,16858-17055,17233-17368,17606-17742,17915-18061,18268-18366,24738-24891,29321-29370
    TCCTGCACAGCTAGAGATCCTTTATTAAAAGCACACTGTTGGTTTCTGCTCAGTTCTTTA
    TTGATTGGTGTGCCGTTTTCTCTGGAAGCCTCTTAAGAACACAGTGGCGCAGGCTGGGTG
    # nope not the same!
    If I reverse complement the whole sequence and then look at the first two lines:
    Code:
    TCCGGCAGAGCGGAAGCGGCGGCGGGAGCTTCCGGGAGGGCGGCTCGCAG
    GCACCATGACTCCTGTGAGGATGCAGCACTCCCTGGCAGGTCAGACCTAT
    # yay this seems to match!

    Now, I sort of remember seeing this a while back, but forget what became of it. Anyone have insight? Is this a bug?

Latest Articles

Collapse

  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin


    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    ...
    01-09-2023, 03:10 PM

ad_right_rmr

Collapse
Working...
X