15bp mystery sequence at the beginning of 454 data

[colinn]

Hello-

So I am working on replicating an analysis from a published study that used 454 sequencing with titanium chemistry, and have downloaded all sequences from the SRA database. Here is an example sequence:

GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAGTAAAAGGCTTGTGGAATGGAGTCTGGCTGAAATCGCTTGCAATGTGCTGCGCACGAAGCCAACATACCGGCTGCCAATGAATTTGAGGCGAGTCCACGCGCTGAGGCGGAACAAACACCCAACACCAAGCATAGCTTGAAGGTTTAAATGACGCTCGAACAGGCATGCCCAACGGAATACCGAAGGGCAATACTAGGTGTGGTCGGCGTCTCTCAAGGCACACAGGGGATAGGNNN

And here is the corresponding barcode/primer sequence sent to me from from the author. barcode bolded, primer underlined:

ACGAGTGCGTTCCTSCGCTTATTGATATGC

Both of these are in this sequence, from the sample:

GACTACACGTAGTAT[B]ACGAGTGCGT[/B][U]TCCTGCGCTTATTGATATGC[/U]TTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAAAGTAAAAGGCTTGTGGAATGGAGTCTGGCTGAAATCGCTTGCAATGTGCTGCGCACGAAGCCAACATACCGGCTGCCAATGAATTTGAGGCGAGTCCACGCGCTGAGGCGGAACAAACACCCAACACCAAGCATAGCTTGAAGGTTTAAATGACGCTCGAACAGGCATGCCCAACGGAATACCGAAGGGCAATACTAGGTGTGGTCGGCGTCTCTCAAGGCACACAGGGGATAGGNNN

However, there is a 15bp sequence preceding the barcode/primer: GACTACACGTAGTAT

I don't know what this is, but it causes my split libraries commands to fail in QIIME. I've seen that some samples in this data set have this identical sequence preceding them, while others have a slightly different sequence but its still 15bp. Any idea what this might be? Is it an artifact of 454 Titanium?

[colinn]

So- this is likely a 454 adaptor sequence that was left in. Its surprisingly difficult to find information on the adaptors online. Can I safely assume the adaptor will be 15bp across the study and go ahead and trim off the first 15bp of each sequence and qual line? Is there a way to tell if this is the A or B adaptor for titanium chemistry?

[Richard Finney]

Is there a database of adapters anywhere that can be searched?

[GenoMax]

This wiki appears to have all 454 sequences: https://wikis.utexas.edu/display/GSAF/454+-+all+flavors

GACT appears to be "key" sequence but that is not for titanium.

[colinn]

it would be surprising, as that would mean the sequences are double barcoded (they used barcoded primers during PCR, before adapter ligation). Also- I see the GACT motif is associated with RAPID chemistry, however authors report they used Titanium chemistry in their manuscript, however they may have misreported this detail.

[GenoMax]

Is that GATC+sequence matching RAPID barcodes in other samples?

[colinn]

Yes, the 15bp sequence seems to be present in every read, although sometimes it is slightly different than the one listed above. THEN there is a 10-12bp barcode, and then there is the primer.

[GenoMax]

But is the "different" part matching other RAPID barcodes (with GATC always at the beginning)?

[colinn]

Yes- the ones that are different still start with 'GACT' as the first four bases of the read, just as the one above.