Reverese complement adapter in mate 1

[arash82]

Hi,

I am still quite a noob at this, so bear with me.

I have some RNA Seq PE-50 data and I am trying to do some adapter trimming. Library was made with a Smarter Race Kit. I was thinking to remove the below adapter form mate 1 and its complementary from mater 2. Curiously, I also find reverse complementary adapters in my mate 1. I have been trying to look at the amplification flow chart but cannot figure how this could happen. Thankful for any hints that could help me understand.

Also, I was expecting the adapter close to the 5' end but can see it over the entire read span. What am I thinking wrong here?

Thanks,

Adapter
AAGCAGTGGTATCAACGCAGAGTAC

[Brian Bushnell]

The adapter can occur anywhere in the read; it just depends on the length of the molecule being sequenced. If you are sequencing small RNAs, for example, the adapter would generally be closer to the beginning of the read.

I'm not sure about the presence of reverse-complementary adapters. What kind of rates are you seeing for forward and reverse adapters in read 1?

[cmbetts]

Could you comment a little on how the library was made? Since the SMARTer RACE kit (or SMARTer kits other than stranded) doesn't make an Illumina sequencing library directly, how the kit's output was processed into the library will dictate where you'd expect the adapter sequences to show up.

[arash82]

What kind of rates are you seeing for forward and reverse adapters in read 1?

Thanks Brian. It is a good point.

Just doing a adapter seque line count in mate 1 I get the following results:
Forward: 12 204
Reverse: 4 600

Obviously much less reverese, but still doesn't make sense to me...

[arash82]

Could you comment a little on how the library was made?

Well, it is all handled by the core facility, so I am rather handicapped here and still learning. I gave them purified transcripted mRNA. Checking my notes it actually says they made the library with a "SMARTer Ultra low", and then sequencing with Illumina HiSeq 2000 for 50PE, if that is any help.

Is there anything more specific I should be looking for?

Thanks,