Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • bioinformatics_ftw
    Junior Member
    • Jun 2015
    • 1

    found strange BLAST behavior... can anyone explain?

    (first post here -- please be kind)
    Hello all!!!

    I've just come across something strange that I am unable to explain. If anyone could enlighten me it would be greatly appreciated. It is related to the translation step in using blastx, tblastn, or tblastx.

    I have a single nucleotide sequence which I have turned into a nucleotide database. If I try to align this sequence to it's own database, I would expect to get a perfect alignment. When I do this using blastN, I do get a perfect alignment. However, when I try to align this sequence to it's own database using TblastX (translated nucleotide sequence to translated nucleotide database) I do NOT get a perfect alignment, I get only a partial alignment. What is it about the translation step that causes this?

    Does anyone know why this would be? I'm at a complete loss...

    Thank you very much for your expertise &/or ideas!!


    Here is the sequence:

    ATGAAGAACTTCCTCATCCTTGCCCTCCTTGCCATGGCGGCGACCATGGCCACTGCCCAGTTTTACCCTAGCGAACAATATCAGCCATATCCTGAGCAACAACAACCATTTCTACAACAACAGCCATTGTTGCAGCAACAACAATTGTTGCAGGTTCTGCAGCAACAGCTGAACCCATGCAGGCAATTCCTCGTGCAACAGTGCAGCCCAGTGGCAGAGGTGCCGTTCCTCCGGTCGCAGATCCTGCAACAGAGCAGCTGCCAGGTGATGAAGCAACAGTGCTGCCGGCAGCTGGCACAGATCCCCGAGCAGGTTCGGTGCCCGGCCATCCATAGTGTCGTGCAAGCCATCATCTTGCAGAAGCTGCAACAACAGTTGCTCCAGCCTCAGCTGCAACAACAGCTGCTCCAGCCTCAGCTGCAACAACAGATTCTCCAGGCTCAGCTCCAACAACAGCTGCTCCAGGCTCAGGTGCAACAACAGCTGCTCCAGCCTCAGGTGCAACAACAGCTGCAACAACAGTTGATCCAGCCTCAGCTGCAACAGGTTTTCATCCCGCCTCAGCTGCAACAGGTTTTCCAGCCTCAGCTGCAACAGGTTTTCCAGCCTCAGCAGCAAGCTCAGTTCGAGGGGATGAGGGCGTTTGCACTGCAGGCCCTGCCGGCGATGTGTGATGTGTATGTTCCACCGCACTGCTCCGTAGCCACCACCCCGCTCGGTGTGGTC

Latest Articles

Collapse

  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    Today, 05:17 AM
  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Today, 10:08 AM
0 responses
6 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, Yesterday, 11:05 AM
0 responses
8 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-30-2026, 05:37 AM
0 responses
29 views
0 reactions
Last Post SEQadmin2  
Working...