Unconfigured Ad

Collapse
X
Collapse
 
  • Page of 2
  • Filter
  • Time
  • Show
Clear All
new posts
Previous 1 2 template Next
  • cmccabe
    Senior Member
    • Jul 2012
    • 355
    #1

    HsMetrics error in header

    I am having trouble with Picard and have tried many things but hopefully am closer now. I have sorted and indexed the TI= and BI= bed files and removed the @PG from the Ion Torrent bam file using the command below:

    Code:
    samtools view -H Input.bam | sed '/^@PG/d' | samtools reheader - Input.bam > Input_newheader.bam
    Example of TI=
    Code:
    chr1	955542	955763	+	chr1:955542-955763
chr1	957570	957852	+	chr1:957570-957852
chr1	976034	976270	+	chr1:976034-976270
chr1	976542	976787	+	chr1:976542-976787
chr1	976847	977092	+	chr1:976847-977092
    Example of BI=
    Code:
    chr1	133573	133692	chr1:133573-133692
chr1	659937	660056	chr1:659937-660056
chr1	809529	809649	chr1:809529-809649
chr1	955542	955662	chr1:955542-955662
chr1	955643	955763	chr1:955643-955763
    and here is the error in Picard:

    Code:
    picard-tools CalculateHsMetrics BI=sort_index_5column_xgen_probes.bed TI=sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam  O=IonXpress_009_150603_all_IDT.CalculateHSmetrics[Fri Jun 26 08:32:55 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics BAIT_INTERVALS=sort_index_5column_xgen_probes.bed TARGET_INTERVALS=sort_index_5column_xgen_targets.bed INPUT=IonXpress_009_150603_newheader.bam OUTPUT=IonXpress_009_150603_all_IDT.CalculateHSmetrics    TMP_DIR=/tmp/dnascopev VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Fri Jun 26 08:32:55 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics done. Elapsed time: 0.00 minutes.
Runtime.totalMemory()=61079552
Exception in thread "main" java.lang.IllegalStateException: Interval list file must contain header.
    at net.sf.picard.util.IntervalList.fromReader(IntervalList.java:176)
    at net.sf.picard.util.IntervalList.fromFile(IntervalList.java:152)
    at net.sf.picard.analysis.directed.HsMetricsCalculator.<init>(HsMetricsCalculator.java:83)
    at net.sf.picard.analysis.directed.CalculateHsMetrics.doWork(CalculateHsMetrics.java:83)
    at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
    at net.sf.picard.analysis.directed.CalculateHsMetrics.main(CalculateHsMetrics.java:68)
    I apologize for the long post, just trying to be thorough. Thank you .
    Tags: None
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142
    #2
    Why not start with the fastq file and make the bam yourself. The alignment file from Ion software appears to have given you enough grief. BTW: You have gone back to the header not found error (which you had gone past the last time around).

    Comment

    • cmccabe
      Senior Member
      • Jul 2012
      • 355
      #3
      Unfortunatly the sequencing is done elsewhere so I do not have access to the fastq and am not sure if they created one. Thank you

      Comment

      • GenoMax
        Senior Member
        • Feb 2008
        • 7142
        #4
        They should be able to create one easily. Have you tried asking?

        Comment

        • cmccabe
          Senior Member
          • Jul 2012
          • 355
          #5
          I will email on Monday, but was hoping that by doing a reheader on the bam and removing the @PG that would help. If I do:

          Does the bed look right? Thank you

          [CODE] cat header.txt TI=.bed > new_TI=.bed [/CODE}

          new_TI=.bed
          Code:
          @HD    VN:1.4    GO:none    SO:coordinate
@SQ    SN:chr1    LN:249250621
@SQ    SN:chr2    LN:243199373
@SQ    SN:chr3    LN:198022430
@SQ    SN:chr4    LN:191154276
@SQ    SN:chr5    LN:180915260
@SQ    SN:chr6    LN:171115067
@SQ    SN:chr7    LN:159138663
@SQ    SN:chr8    LN:146364022
@SQ    SN:chr9    LN:141213431
@SQ    SN:chr10    LN:135534747
@SQ    SN:chr11    LN:135006516
@SQ    SN:chr12    LN:133851895
@SQ    SN:chr13    LN:115169878
@SQ    SN:chr14    LN:107349540
@SQ    SN:chr15    LN:102531392
@SQ    SN:chr16    LN:90354753
@SQ    SN:chr17    LN:81195210
@SQ    SN:chr18    LN:78077248
@SQ    SN:chr19    LN:59128983
@SQ    SN:chr20    LN:63025520
@SQ    SN:chr21    LN:48129895
@SQ    SN:chr22    LN:51304566
@SQ    SN:chrX    LN:155270560
@SQ    SN:chrY    LN:59373566
@SQ    SN:chrM    LN:16569
@RG    ID:8AH6U.IonXpress_009    PL:IONTORRENT    PU:Unspecified/P1.1.17/IonXpress_009    FO:TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACG    DT:2015-06-03T14:03:02-0700    SM:E1    PG:tmap    KS:TCAGTGAGCGGAACGAT    CN:TorrentServer/Proton
@RG    ID:8AH6U.IonXpress_009.1    PL:IONTORRENT    PU:Unspecified/P1.1.17/IonXpress_009

chr1    133573    133692    chr1:133573-133692
chr1    659937    660056    chr1:659937-660056
chr1    809529    809649    chr1:809529-809649
chr1    955542    955662    chr1:955542-955662
          EDIT: it must not be I tried and get this error(a new one)

          Code:
          dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ cat header.txt sort_index_5column_xgen_probes.bed > sam_sort_index_5column_xgen_probes.bed
dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ cat header.txt sort_index_5column_xgen_targets.bed > sam_sort_index_5column_xgen_targets.bed
dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ picard-tools CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam  O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
[Sat Jun 27 09:30:11 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics BAIT_INTERVALS=sam_sort_index_5column_xgen_probes.bed TARGET_INTERVALS=sam_sort_index_5column_xgen_targets.bed INPUT=IonXpress_009_150603_newheader.bam OUTPUT=IonXpress_009_150603_all_IDT.CalculateHSmetrics    TMP_DIR=/tmp/dnascopev VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Sat Jun 27 09:30:11 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=90243072
[B]Exception in thread "main" net.sf.picard.PicardException: Invalid interval record contains 4 fields: chr1	133573	133692	-[/B]
	at net.sf.picard.util.IntervalList.fromReader(IntervalList.java:192)
	at net.sf.picard.util.IntervalList.fromFile(IntervalList.java:152)
	at net.sf.picard.analysis.directed.HsMetricsCalculator.<init>(HsMetricsCalculator.java:83)
	at net.sf.picard.analysis.directed.CalculateHsMetrics.doWork(CalculateHsMetrics.java:83)
	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
	at net.sf.picard.analysis.directed.CalculateHsMetrics.main(CalculateHsMetrics.java:68)
          Last edited by cmccabe; 06-27-2015, 06:35 AM. Reason: added edit

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142
            #6
            Your interval file needs to look something like this (example from https://www.broadinstitute.org/gatk/...icle?id=1204):

            Code:
            @HD     VN:1.0  SO:coordinate
@SQ     SN:1    LN:249250621    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:1b22b98cdeb4a9304cb5d48026a85128     SP:Homo Sapiens
@SQ     SN:2    LN:243199373    AS:GRCh37       UR:http://www.broadinstitute.org/ftp/pub/seq/references/Homo_sapiens_assembly19.fasta   M5:a0d9851da00400dec1098a9255ac712e     SP:Homo Sapiens
1       30366   30503   +       target_1
1       69089   70010   +       target_2
1       367657  368599  +       target_3
1       621094  622036  +       target_4
            Fourth field is strand. Remove that blank line between the headers and start of your data.

            Comment

            • cmccabe
              Senior Member
              • Jul 2012
              • 355
              #7
              Appears not to like the interval files, but not sure why? Thanks .

              Code:
              dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ picard-tools CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam  O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
[Mon Jun 29 10:54:45 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics BAIT_INTERVALS=sam_sort_index_5column_xgen_probes.bed TARGET_INTERVALS=sam_sort_index_5column_xgen_targets.bed INPUT=IonXpress_009_150603_newheader.bam OUTPUT=IonXpress_009_150603_all_IDT.CalculateHSmetrics    TMP_DIR=/tmp/dnascopev VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Mon Jun 29 10:54:45 CDT 2015] net.sf.picard.analysis.directed.CalculateHsMetrics done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=61079552
Exception in thread "main" net.sf.picard.PicardException: Invalid interval record contains 4 fields: chr1	133573	133692	-
	at net.sf.picard.util.IntervalList.fromReader(IntervalList.java:192)
	at net.sf.picard.util.IntervalList.fromFile(IntervalList.java:152)
	at net.sf.picard.analysis.directed.HsMetricsCalculator.<init>(HsMetricsCalculator.java:83)
	at net.sf.picard.analysis.directed.CalculateHsMetrics.doWork(CalculateHsMetrics.java:83)
	at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:158)
	at net.sf.picard.analysis.directed.CalculateHsMetrics.main(CalculateHsMetrics.java:68)
              BI=
              Code:
              @HD	VN:1.4	GO:none	SO:coordinate
@SQ	SN:chr1	LN:249250621
@SQ	SN:chr2	LN:243199373
@SQ	SN:chr3	LN:198022430
@SQ	SN:chr4	LN:191154276
@SQ	SN:chr5	LN:180915260
@SQ	SN:chr6	LN:171115067
@SQ	SN:chr7	LN:159138663
@SQ	SN:chr8	LN:146364022
@SQ	SN:chr9	LN:141213431
@SQ	SN:chr10	LN:135534747
@SQ	SN:chr11	LN:135006516
@SQ	SN:chr12	LN:133851895
@SQ	SN:chr13	LN:115169878
@SQ	SN:chr14	LN:107349540
@SQ	SN:chr15	LN:102531392
@SQ	SN:chr16	LN:90354753
@SQ	SN:chr17	LN:81195210
@SQ	SN:chr18	LN:78077248
@SQ	SN:chr19	LN:59128983
@SQ	SN:chr20	LN:63025520
@SQ	SN:chr21	LN:48129895
@SQ	SN:chr22	LN:51304566
@SQ	SN:chrX	LN:155270560
@SQ	SN:chrY	LN:59373566
@SQ	SN:chrM	LN:16569
chr1	133573	133692	-
	chr1:133573-133692
chr1	659937	660056	-
	chr1:659937-660056
chr1	809529	809649	+
	chr1:809529-809649
chr1	955542	955662	+
	chr1:955542-955662
chr1	955643	955763	+
	chr1:955643-955763
chr1	957570	957690	+
	chr1:957570-957690
chr1	957651	957771	+
	chr1:957651-957771
chr1	957732	957852	+
	chr1:957732-957852
chr1	970620	970740	+
	chr1:970620-970740
chr1	976034	976154	+
	chr1:976034-976154
chr1	976149	976269	+
	chr1:976149-976269
chr1	976542	976662	+
	chr1:976542-976662
chr1	976605	976725	+
	chr1:976605-976725
chr1	976667	976787	+
	chr1:976667-976787
chr1	976847	976967	+
	chr1:976847-976967
chr1	976910	977030	+
	chr1:976910-977030
chr1	976972	977092	+
	chr1:976972-977092
chr1	977325	977445	+
	chr1:977325-977445
chr1	977432	977552	+
	chr1:977432-977552
chr1	978608	978728	+
	chr1:978608-978728
chr1	978727	978847	+
	chr1:978727-978847
chr1	978907	979027	+
	chr1:978907-979027
chr1	979002	979122	+
	chr1:979002-979122
chr1	979192	979312	+
	chr1:979192-979312
chr1	979293	979413	+
	chr1:979293-979413
chr1	979478	979598	+
	chr1:979478-979598
chr1	979527	979647	+
	chr1:979527-979647
chr1	979703	979823	+
	chr1:979703-979823
chr1	979709	979829	+
	chr1:979709-979829
chr1	980530	980650	+
	chr1:980530-980650
chr1	980547	980667	+
	chr1:980547-980667
chr1	980728	980848	+
	chr1:980728-980848
chr1	980793	980913	+
	chr1:980793-980913
              TI=
              Code:
              @HD	VN:1.4	GO:none	SO:coordinate
@SQ	SN:chr1	LN:249250621
@SQ	SN:chr2	LN:243199373
@SQ	SN:chr3	LN:198022430
@SQ	SN:chr4	LN:191154276
@SQ	SN:chr5	LN:180915260
@SQ	SN:chr6	LN:171115067
@SQ	SN:chr7	LN:159138663
@SQ	SN:chr8	LN:146364022
@SQ	SN:chr9	LN:141213431
@SQ	SN:chr10	LN:135534747
@SQ	SN:chr11	LN:135006516
@SQ	SN:chr12	LN:133851895
@SQ	SN:chr13	LN:115169878
@SQ	SN:chr14	LN:107349540
@SQ	SN:chr15	LN:102531392
@SQ	SN:chr16	LN:90354753
@SQ	SN:chr17	LN:81195210
@SQ	SN:chr18	LN:78077248
@SQ	SN:chr19	LN:59128983
@SQ	SN:chr20	LN:63025520
@SQ	SN:chr21	LN:48129895
@SQ	SN:chr22	LN:51304566
@SQ	SN:chrX	LN:155270560
@SQ	SN:chrY	LN:59373566
@SQ	SN:chrM	LN:16569
chr1	955542	955763	+	chr1:955542-955763
chr1	957570	957852	+	chr1:957570-957852
chr1	976034	976270	+	chr1:976034-976270
chr1	976542	976787	+	chr1:976542-976787
chr1	976847	977092	+	chr1:976847-977092
chr1	977325	977552	+	chr1:977325-977552
chr1	978608	978847	+	chr1:978608-978847
chr1	978907	979122	+	chr1:978907-979122
chr1	979192	979413	+	chr1:979192-979413
chr1	979478	979647	+	chr1:979478-979647
chr1	979703	979829	+	chr1:979703-979829
chr1	980530	980667	+	chr1:980530-980667
chr1	980728	980913	+	chr1:980728-980913
chr1	981102	981266	+	chr1:981102-981266
chr1	981333	981478	+	chr1:981333-981478
chr1	981529	981655	+	chr1:981529-981655
chr1	981766	982125	+	chr1:981766-982125
chr1	982189	982347	+	chr1:982189-982347
chr1	982696	982844	+	chr1:982696-982844
chr1	982942	983077	+	chr1:982942-983077
chr1	983145	983285	+	chr1:983145-983285
chr1	983381	983755	+	chr1:983381-983755
chr1	984236	984449	+	chr1:984236-984449
chr1	984605	984841	+	chr1:984605-984841
chr1	984935	985185	+	chr1:984935-985185
chr1	985272	985427	+	chr1:985272-985427
chr1	985602	985719	+	chr1:985602-985719
chr1	985796	985981	+	chr1:985796-985981
chr1	986095	986227	+	chr1:986095-986227
chr1	986622	986759	+	chr1:986622-986759
chr1	986822	987035	+	chr1:986822-987035
chr1	987097	987205	+	chr1:987097-987205
chr1	989122	989367	+	chr1:989122-989367
chr1	989817	989941	+	chr1:989817-989941
chr1	990193	990371	+	chr1:990193-990371
chr1	1167648	1168658	+	chr1:1167648-1168658
chr1	1266715	1266926	+	chr1:1266715-1266926
chr1	1267007	1267328	+	chr1:1267007-1267328
chr1	1267393	1268196	+	chr1:1267393-1268196
chr1	1268290	1268514	+	chr1:1268290-1268514
chr1	1268628	1268769	+	chr1:1268628-1268769
chr1	1268875	1269854	+	chr1:1268875-1269854
chr1	1647774	1647927	+	chr1:1647774-1647927
chr1	1650756	1650904	+	chr1:1650756-1650904
chr1	1950852	1950940	+	chr1:1950852-1950940
chr1	1956370	1956503	+	chr1:1956370-1956503
chr1	1956762	1956850	+	chr1:1956762-1956850
chr1	1956946	1957187	+	chr1:1956946-1957187
chr1	1959005	1959108	+	chr1:1959005-1959108
chr1	1959583	1959741	+	chr1:1959583-1959741
chr1	1960539	1960715	+	chr1:1960539-1960715
chr1	1960979	1961211	+	chr1:1960979-1961211
chr1	1961411	1961731	+	chr1:1961411-1961731
chr1	2160195	2161184	+	chr1:2160195-2161184
chr1	2234406	2234552	+	chr1:2234406-2234552
chr1	2234713	2234849	+	chr1:2234713-2234849
chr1	2235268	2235551	+	chr1:2235268-2235551
chr1	2235721	2236034	+	chr1:2235721-2236034
chr1	2237448	2237699	+	chr1:2237448-2237699
chr1	2238005	2238214	+	chr1:2238005-2238214
chr1	2337194	2337283	+	chr1:2337194-2337283
chr1	2337912	2338068	+	chr1:2337912-2338068
chr1	2338148	2338404	+	chr1:2338148-2338404
chr1	2339880	2340307	+	chr1:2339880-2340307
chr1	2341799	2341900	+	chr1:2341799-2341900
chr1	2343819	2343951	+	chr1:2343819-2343951
chr1	2522418	2522538	+	chr1:2522418-2522538
chr1	2522985	2523082	+	chr1:2522985-2523082
chr1	2523360	2523476	+	chr1:2523360-2523476
chr1	2524083	2524169	+	chr1:2524083-2524169
chr1	2524261	2524415	+	chr1:2524261-2524415
chr1	2525242	2525382	+	chr1:2525242-2525382
chr1	2525813	2525892	+	chr1:2525813-2525892
chr1	2526218	2526342	+	chr1:2526218-2526342
chr1	2526704	2526808	+	chr1:2526704-2526808
chr1	2527437	2527556	+	chr1:2527437-2527556
chr1	2527989	2528138	+	chr1:2527989-2528138
chr1	2529635	2529749	+	chr1:2529635-2529749
chr1	2530082	2530239	+	chr1:2530082-2530239
chr1	2535312	2535422	+	chr1:2535312-2535422
chr1	2535575	2535730	+	chr1:2535575-2535730
chr1	2536986	2537072	+	chr1:2536986-2537072
chr1	2537676	2537815	+	chr1:2537676-2537815
chr1	2538402	2538518	+	chr1:2538402-2538518
chr1	2540767	2540868	+	chr1:2540767-2540868
chr1	2541098	2541280	+	chr1:2541098-2541280
chr1	2542709	2542789	+	chr1:2542709-2542789
chr1	2543555	2543653	+	chr1:2543555-2543653
chr1	2560759	2560933	+	chr1:2560759-2560933
chr1	3102678	3103048	+	chr1:3102678-3103048
chr1	3301705	3301860	+	chr1:3301705-3301860
chr1	3313044	3313167	+	chr1:3313044-3313167
chr1	3319344	3319572	+	chr1:3319344-3319572
chr1	3321292	3321460	+	chr1:3321292-3321460
chr1	3322048	3322222	+	chr1:3322048-3322222
chr1	3327937	3329374	+	chr1:3327937-3329374
chr1	3331113	3331221	+	chr1:3331113-3331221
chr1	3334381	3334571	+	chr1:3334381-3334571
chr1	3335220	3335318	+	chr1:3335220-3335318
chr1	3342134	3342324	+	chr1:3342134-3342324
chr1	3342604	3342799	+	chr1:3342604-3342799
chr1	3347425	3347682	+	chr1:3347425-3347682
chr1	3348519	3348714	+	chr1:3348519-3348714
chr1	3350230	3350385	+	chr1:3350230-3350385
chr1	3598919	3599004	+	chr1:3598919-3599004
chr1	3599613	3599754	+	chr1:3599613-3599754
chr1	3624102	3624365	+	chr1:3624102-3624365
chr1	3638574	3638781	+	chr1:3638574-3638781
chr1	3639907	3640043	+	chr1:3639907-3640043
chr1	3643668	3643798	+	chr1:3643668-3643798
chr1	3644181	3644344	+	chr1:3644181-3644344
chr1	3644682	3644791	+	chr1:3644682-3644791
chr1	3645880	3646022	+	chr1:3645880-3646022
chr1	3646553	3646722	+	chr1:3646553-3646722
chr1	3647480	3647639	+	chr1:3647480-3647639
chr1	3648016	3648130	+	chr1:3648016-3648130
chr1	3649300	3649653	+	chr1:3649300-3649653
chr1	5923314	5923475	+	chr1:5923314-5923475
chr1	5923939	5924103	+	chr1:5923939-5924103
chr1	5924387	5924587	+	chr1:5924387-5924587
chr1	5925151	5925343	+	chr1:5925151-5925343
chr1	5926422	5926528	+	chr1:5926422-5926528
chr1	5927079	5927185	+	chr1:5927079-5927185
chr1	5927789	5927966	+	chr1:5927789-5927966
chr1	5933301	5933405	+	chr1:5933301-5933405
chr1	5934520	5934727	+	chr1:5934520-5934727
chr1	5934923	5935170	+	chr1:5934923-5935170
chr1	5937142	5937368	+	chr1:5937142-5937368
chr1	5940163	5940309	+	chr1:5940163-5940309
chr1	5947335	5947536	+	chr1:5947335-5947536
chr1	5950917	5951098	+	chr1:5950917-5951098
chr1	5964666	5964874	+	chr1:5964666-5964874
chr1	5965341	5965553	+	chr1:5965341-5965553
chr1	5965681	5965853	+	chr1:5965681-5965853
chr1	5967164	5967292	+	chr1:5967164-5967292
chr1	5969201	5969283	+	chr1:5969201-5969283
chr1	5987698	5987857	+	chr1:5987698-5987857
chr1	5993196	5993399	+	chr1:5993196-5993399
chr1	6007153	6007300	+	chr1:6007153-6007300
chr1	6008119	6008321	+	chr1:6008119-6008321
chr1	6012749	6012906	+	chr1:6012749-6012906
chr1	6021843	6022019	+	chr1:6021843-6022019
chr1	6027348	6027433	+	chr1:6027348-6027433
chr1	6029136	6029329	+	chr1:6029136-6029329
chr1	6038319	6038483	+	chr1:6038319-6038483
chr1	6046204	6046359	+	chr1:6046204-6046359
chr1	6100618	6100715	+	chr1:6100618-6100715
chr1	6111586	6111824	+	chr1:6111586-6111824
chr1	6142244	6142344	+	chr1:6142244-6142344
chr1	6150438	6150545	+	chr1:6150438-6150545
chr1	6154449	6154555	+	chr1:6154449-6154555
chr1	6155372	6155513	+	chr1:6155372-6155513
chr1	6155579	6155694	+	chr1:6155579-6155694
chr1	6156685	6156826	+	chr1:6156685-6156826
chr1	6157318	6157427	+	chr1:6157318-6157427
chr1	6158534	6158644	+	chr1:6158534-6158644
chr1	6485005	6485319	+	chr1:6485005-6485319
chr1	6488270	6488494	+	chr1:6488270-6488494
chr1	6500303	6500510	+	chr1:6500303-6500510
chr1	6500675	6500878	+	chr1:6500675-6500878
chr1	6500983	6501135	+	chr1:6500983-6501135
chr1	6504525	6504757	+	chr1:6504525-6504757
chr1	6505713	6506005	+	chr1:6505713-6506005
chr1	6508690	6509161	+	chr1:6508690-6509161
chr1	6511647	6511823	+	chr1:6511647-6511823
chr1	6511882	6512166	+	chr1:6511882-6512166
chr1	6517228	6517338	+	chr1:6517228-6517338
chr1	6520043	6520221	+	chr1:6520043-6520221
chr1	6527874	6528656	+	chr1:6527874-6528656
chr1	6529091	6529311	+	chr1:6529091-6529311
chr1	6529384	6529520	+	chr1:6529384-6529520
chr1	6529593	6529746	+	chr1:6529593-6529746
chr1	6530285	6530425	+	chr1:6530285-6530425
chr1	6530555	6530713	+	chr1:6530555-6530713
chr1	6530784	6530954	+	chr1:6530784-6530954
chr1	6531039	6531170	+	chr1:6531039-6531170
chr1	6531537	6531707	+	chr1:6531537-6531707
chr1	6532576	6532692	+	chr1:6532576-6532692
chr1	6533035	6533244	+	chr1:6533035-6533244
chr1	6533300	6533524	+	chr1:6533300-6533524
chr1	6534062	6534234	+	chr1:6534062-6534234
chr1	6534500	6534657	+	chr1:6534500-6534657
chr1	6535096	6535208	+	chr1:6535096-6535208
chr1	6535511	6535592	+	chr1:6535511-6535592
chr1	6535980	6536106	+	chr1:6535980-6536106
chr1	6537578	6537728	+	chr1:6537578-6537728
chr1	6545373	6545513	+	chr1:6545373-6545513
chr1	6556542	6556639	+	chr1:6556542-6556639
chr1	6557008	6557101	+	chr1:6557008-6557101
chr1	6579494	6579581	+	chr1:6579494-6579581
chr1	6615423	6615634	+	chr1:6615423-6615634
chr1	6630958	6631285	+	chr1:6630958-6631285
chr1	6634680	6635462	+	chr1:6634680-6635462
chr1	6636464	6636697	+	chr1:6636464-6636697
chr1	6636999	6637140	+	chr1:6636999-6637140
              Last edited by cmccabe; 06-29-2015, 09:29 AM.

              Comment

              • kmcarr
                Senior Member
                • May 2008
                • 1181
                #8
                Seems pretty obvious that your baits interval file has had extra newlines inserted between the 4th and 5th fields of every line. You have to change every entry that looks like:

                Code:
                chr1	133573	133692	-
	chr1:133573-133692
                To look like:

                Code:
                chr1	133573	133692	-	chr1:133573-133692

                Comment

                • cmccabe
                  Senior Member
                  • Jul 2012
                  • 355
                  #9
                  I have fixed the baits file, but am getting another error.

                  Exception in thread "main" net.sf.samtools.SAMFormatException: Unrecognized tag type: B

                  which I think may be related to the version of picard-tools.

                  I downloaded from
                  Code:
                   sudo apt-get install picard-tools

dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ picard-tools --version
picard-tools
Copyright 2010 The Broad Institute
                  Do you have any sugesstions? Thank you .

                  Comment

                  • GenoMax
                    Senior Member
                    • Feb 2008
                    • 7142
                    #10
                    @cmccabe: Download the latest picard directly from broad (http://broadinstitute.github.io/picard/) and see if that fixes your interval file woes. I think you are using a fairly old version of picard tools that you got from apt-get.

                    Comment

                    • cmccabe
                      Senior Member
                      • Jul 2012
                      • 355
                      #11
                      I did:
                      Code:
                      wget https://github.com/broadinstitute/picard/tarball/master -O - | tar -zxf -
                      to download and extract picard-1.135

                      I added it to path
                      Code:
                      export PATH=$PATH:"/media/C2F8EFBFF8EFAFB9"
                      but can not seem to invoke it correctly:

                      Code:
                      java -jar picard-1.135/picard-1.135 CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
Unable to access jarfile picard-1.135/picard-1.135
                      Code:
                      picard-1.135 CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
picard-1.135: command not found
                      Thank you very much .

                      Comment

                      • GenoMax
                        Senior Member
                        • Feb 2008
                        • 7142
                        #12
                        Assuming your picard.jar file is in the following location (otherwise substitute correct path):

                        Code:
                        $ java -jar picard-1.135/picard-1.135/picard.jar CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics

                        Comment

                        • cmccabe
                          Senior Member
                          • Jul 2012
                          • 355
                          #13
                          How do I find where picard.jar got saved? Thank you .

                          Code:
                          dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ java -jar picard-1.135/picard-1.135 CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
Unable to access jarfile picard-1.135/picard-1.135
dnascopev@ubuntu:/media/C2F8EFBFF8EFAFB9$ java -jar picard-1.135/picard-1.135/picard.jar CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
Unable to access jarfile picard-1.135/picard-1.135/picard.jar

                          Comment

                          • GenoMax
                            Senior Member
                            • Feb 2008
                            • 7142
                            #14
                            I think you downloaded the source code for picard.

                            Get this zip file instead: https://github.com/broadinstitute/pi...ools-1.135.zip

                            When you uncompress it, picard.jar file should be right under the "picard-tools-1.135" folder.

                            Comment

                            • cmccabe
                              Senior Member
                              • Jul 2012
                              • 355
                              #15
                              I downloaded the correct zip (as you suspected I did have the source code)

                              Code:
                              export PATH=$PATH:"/media/C2F8EFBFF8EFAFB9/picard-tools-1.135"
                              However:

                              Code:
                              dnascopev@ubuntu:~$ java -jar picard-tools-1.135/media/C2F8EFBFF8EFAFB9/picard-tools-1.135/picard.jar CalculateHsMetrics BI=sam_sort_index_5column_xgen_probes.bed TI=sam_sort_index_5column_xgen_targets.bed I=IonXpress_009_150603_newheader.bam O=IonXpress_009_150603_all_IDT.CalculateHSmetrics
Unable to access jarfile picard-tools-1.135/media/C2F8EFBFF8EFAFB9/picard-tools-1.135/picard.jar
                              Thank you .

                              Comment

                              Previous 1 2 template Next

                              Latest Articles

                              Collapse
                              View All

                              ad_right_rmr

                              Collapse

                              News

                              Collapse
                              Topics Statistics Last Post
                              A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2
                              Started by SEQadmin2, 06-05-2026, 10:09 AM
                              0 responses
                              12 views
                              0 reactions
                              		 Last Post SEQadmin2
                              by SEQadmin2
                              06-05-2026, 10:09 AM  
                              A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2
                              Started by SEQadmin2, 06-04-2026, 08:59 AM
                              0 responses
                              23 views
                              0 reactions
                              		 Last Post SEQadmin2
                              by SEQadmin2
                              06-04-2026, 08:59 AM  
                              Long-Read RNA Sequencing Uncovers a Hidden Layer of Immune Cell Regulation by SEQadmin2
                              Started by SEQadmin2, 06-02-2026, 12:03 PM
                              0 responses
                              28 views
                              0 reactions
                              		 Last Post SEQadmin2
                              by SEQadmin2
                              06-02-2026, 12:03 PM  
                              DNA Methylation Study Reveals How Epigenetic Changes Pass Between Generations by SEQadmin2
                              Started by SEQadmin2, 06-02-2026, 11:40 AM
                              0 responses
                              22 views
                              0 reactions
                              		 Last Post SEQadmin2
                              by SEQadmin2
                              06-02-2026, 11:40 AM  
                              View All
                              Working...