Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • swbarnes2
    replied
    Originally posted by donniemarco View Post
    I think its -F 4 option in BWA!!!
    I don't see -F as an option in either bwa aln or sampe

    but bwa aln -n 0 might do the trick. Or, if you already have sam files, you could filter them with grep to only contain lines with "NM:i:0" That means a perfect match.

    Leave a comment:


  • donniemarco
    replied
    Originally posted by mghita View Post
    Hi,

    What options should I use in bwa in order to obtain perfect maps only? I have two references and I would like to get the unique perfect maps to both of them (in two different files if possible).

    Thanks!
    I think its -F 4 option in BWA!!!

    Leave a comment:


  • mghita
    replied
    Hi,

    What options should I use in bwa in order to obtain perfect maps only? I have two references and I would like to get the unique perfect maps to both of them (in two different files if possible).

    Thanks!

    Leave a comment:


  • frymor
    replied
    Originally posted by aleferna View Post
    Minimum MapQ value in BWA.
    I have a small python script to filter a fastq file if you want it.
    Hi,

    I would like to have a look at the python script.

    I run the fastqc software on my data before start using the bwa algorithm. I found out that at both ends there are still some adapter sequences which I would like to trimm.

    It would be great if I can have a look at your script.

    Leave a comment:


  • donniemarco
    replied
    thanks for your reply Aleferna. Its a great help. I have cleaned my sequences already.

    Leave a comment:


  • aleferna
    replied
    Minimum MapQ value in BWA.

    I ran some simulations with bwa in Single End Mapping and it really depends on the read length and the number of mismatches. Also the mapq value of BWA ALN (the short aligner) you should use MapQ > 30 anything less than that you pretty much cannot trust. If you use bwasw you can use a MapQ of 10. These 2 settings should give you >99% accuracy in the mapping, specially if you increase the sensitivity in BWASW (Z > 100). This however is for Single End mapping not Paired End mapping.

    Hint: 45 mismatches is probably a paired end adapter, did you mask your sequences ? Its a good idea to check your fastq file for the Solexa PE adapters. In my case I had A LOT of contamination from these adapters, that makes it harder to map. I have a small python script to filter a fastq file if you want it.
    Last edited by aleferna; 08-06-2010, 05:06 AM.

    Leave a comment:


  • donniemarco
    replied
    bwa minimum map quality

    Is there as anything as minimum or optimal mapq in the bwa.

    I plan to take unique query sequences with highest mapq but still not able to figure the cutoff to use it for the analysis.

    Any help is appreciated!!

    Leave a comment:


  • lh3
    replied
    It cannot be 45 mismatches. It must be soft clipping.

    For PE reads, bwa runs SW alignment for unpaired mate. SW is much more permissive. This procedure is rewritten in the paper, not phantom. You may filter the alignment if you do not like them.

    Leave a comment:


  • hash
    replied
    Mismatch threshold for both reads in a paired-end run

    Hi,

    One of my colleagues has found that when he aligns 80bp paired-end reads using bwa that the mismatch threshold only applies to any one of the two sequences and the other can have as many mismatches as permitted. For example, one paired read can have the default two mismatches and the other paired read had 45 mismatches. Is there an option in bwa to set the mismatch level on both paired reads because it is going to be quite unproductive to have to parse the resulting SAM file. Please give me some good news with regard to phantom parameters. Look forward to hearing from you.

    Harshil

    Leave a comment:


  • lh3
    replied
    Mapping quality. See samtools FAQ.

    Leave a comment:


  • christophpale
    started a topic BWA unique mapping, mutireads

    BWA unique mapping, mutireads

    Hi,
    Question: What is the best way to remove reads that map to multiple locations?

    What I have done so far:
    I have a 76x2 paired end data which I mapped to hg18 using BWA.
    I want to get rid of reads that map to multiple locations, so I was
    told to use the cutoff of -q 1 in samtools view;
    however, to my surprise, I have reads with non-zero quality but appear to map to alternative locations with the same score.
    For example, this read maps to chr1 and also to chrM

    Code:
    PF_Y_612GW_I581:100617:1:21:8990:3211#0 89      chr1    557906  23      76M     *       0       0       CCCATGGCCTCCATGACTTTTTCAAAAAGATATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGC    HHHHDHH>HBHHHHHHGHHHH>HGHHHHHHHHGFHHHHHFHGGDGGDHHHHFHFHHHHHHHHFHHHEHHHGGDGGG    XT:A:U  NM:i:0  SM:i:23 AM:i:0  X0:i:1  X1:i:1  XM:i:0  XO:i:0  XG:i:0  MD:Z:76 XA:Z:chrM,-7493,76M,1;
    XA tag is the BWA optional field and if I understand correctly it means that this sequence also mapped to chrM with 100% matches;
    so it appears that it is not sufficient to use the -q 1 as the flag to remove multiple hits.

    Can someone tell me if I am correct; and also what is the best way to get rid of reads that align non-uniquely on the genome.


    thanks
    Christoph

Latest Articles

Collapse

  • GATTACAT
    Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by GATTACAT
    Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
    07-01-2026, 11:43 AM
  • SEQadmin2
    Nine Things a Sample Prep Scientist Thinks About Before Sequencing
    by SEQadmin2


    I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

    Here are nine questions we think about, in roughly the order they matter, before...
    06-18-2026, 07:11 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-30-2026, 05:37 AM
0 responses
13 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-26-2026, 11:10 AM
0 responses
20 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 06-17-2026, 06:09 AM
0 responses
54 views
0 reactions
Last Post SEQadmin2  
Working...