I am trying to convert the output of blast in a .sam or .bam file using the blast2sam tool.
The alignement of the reads has been done with the command
blastn -query 130205_UNC11-SN627_0280_AC1NEKACXX_TTAGGC_L004_1.fasta -db blast_ref -word_size 15 -outfmt "6 qseqid sseqid pident nident length mismatch positive gapopen gaps ppos qframe sframe sstrand qcovs qstart qend qseq sstart send sseq evalue bitscore score" -out blast_tab
This is the first line of the output blast_tab:
UNC11-SN627:280:C1NEKACXX:4:1101:11031:1976 sequenzadifusione 93.62 44 3 44 0 0 93.62 1 1 plus 98 2 48 TGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATTGCGCCACTGC 24710 24756 TGAACCCGGGAGGTGGAGGCTGCAGTGAGCTGAGATAGCGCCACTGC 6e-16 71.3 38
Then the conversion has been done with the command blast2sam (not blast2bam)
blast2sam.pl blast_tab > blast.sam
For the conversion we didn't use the default format, but the tabular format of the output of blast.
In the conversion there aren't errors, but the output file blast.sam is empty.
Where can be the error?
Is there another tool to make the conversion or another alignment tool for which it is possible to specify the output format as .sam or .bam?
The alignement of the reads has been done with the command
blastn -query 130205_UNC11-SN627_0280_AC1NEKACXX_TTAGGC_L004_1.fasta -db blast_ref -word_size 15 -outfmt "6 qseqid sseqid pident nident length mismatch positive gapopen gaps ppos qframe sframe sstrand qcovs qstart qend qseq sstart send sseq evalue bitscore score" -out blast_tab
This is the first line of the output blast_tab:
UNC11-SN627:280:C1NEKACXX:4:1101:11031:1976 sequenzadifusione 93.62 44 3 44 0 0 93.62 1 1 plus 98 2 48 TGAACCCGGGAGGTGGAGGTTGCAGTGAGCCGAGATTGCGCCACTGC 24710 24756 TGAACCCGGGAGGTGGAGGCTGCAGTGAGCTGAGATAGCGCCACTGC 6e-16 71.3 38
Then the conversion has been done with the command blast2sam (not blast2bam)
blast2sam.pl blast_tab > blast.sam
For the conversion we didn't use the default format, but the tabular format of the output of blast.
In the conversion there aren't errors, but the output file blast.sam is empty.
Where can be the error?
Is there another tool to make the conversion or another alignment tool for which it is possible to specify the output format as .sam or .bam?
Comment