using bioperl to parse genome based on basepair location

[ninja_help]

Hello all
I have a genome that I am looking to parse a genome based on another file that has a name associated with the coordinates of the specific name in the genome of my species (for this purpose I will just use the first line of the fasta file of the genome)

My coordinate file looks like the lines below

name1 20 35
name2 35 40
name2 1 4

The genome file looks like the one below

GL849905.1 dna:scaffold:GL849905.1:1:5315331:1 REF
TTATATTCATATATTTATATATATATATATATATATTATATATACACACACATATCCAGATACAGGCTCATAAACATGCATACACGTGTGCATATACCATGCTAAATTCGCACAAATACATATACGAATACACATACCGCACTGTGCCTTTACATATATAGAAACGTACGCATATTTGACTCACGCGCATACACACAATGCCTGCACACACACATACCTACATAATAAACATAGACTGAGATTTAGGACCAGAACTAAAGGCTCAATAAGCATTTATTAAGCACCTACAGCATGCCAAAC

I am new to using bioperl but i know that you can implement

$string = $seq_obj->subseq(20,35)

to extract that specific sequence, my problem is I am working on a much bigger scale and with many more names and locations. So I know I need to open one file (the one with the names and coordinates) to loop through and substitute for the 20, 35 each time but I don't know how to accomplish this through bioperl. I can extract one string based on one location but implementing it on a grander scale is giving me problems.

Cheers

[dgscofield]

BioPerl is great, but unless this is just one small task in the midst of several things you want to do with these sequences using BioPerl, I would recommend you turn your coordinate file into BED3 format (watch the coordinates!) and use the bedtools getfasta command to extract the sequences. It is fast and you are very close to being done already.

[ninja_help]

thanks for the reply @dgscofield

by BED3 format do you mean this under the BED format section?

[GenoMax]

That is correct. Getfasta description is here: http://bedtools.readthedocs.org/en/l.../getfasta.html

[ninja_help]

I have another question regarding the BED format (my apologies for so many questions)
I dont know what scaffold the locations are located on, would that impair me from using BED
since they require scaffold or chromosome number?
the names of specific sequences and coordinates are associated with each other, but aren't the actual scaffold within the genome.