Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • litali
    Member
    • Jul 2010
    • 78

    #1

    maq for 454 data?

    Hi,
    Is it possible to use Maq for 454 data? which are the input files needed? if no, is there anything similar for 454?
  • Naujv
    Junior Member
    • Jul 2010
    • 6

    #2
    Hi litali,

    I'm not sure if it's the right thing to do, the MAQ website FAQ section actually says: "Maq maps short reads to the reference and calls the genotypes from the alignment. It is speficially designed for Illumina-Solexa/AB-SOLiD reads, not for 454 or capillary ones." Personally, I'd like to use it too since I'm not too hot on Roche software.

    If you want to run it and see for yourself, you can convert your sff files into sanger fastq (several methods below), make a reference fasta file, and follow the commands shown at the MAQ website (there's an easyrun).

    Join qual and fna file into fastq:
    (a) http://seqanswers.com/forums/showthread.php?t=2775
    Convert sff into fastq:
    (b) There's also sff2fastq at github.

    The files came out the same with either code.
    Last edited by Naujv; 07-22-2010, 11:39 PM.

    Comment

    • Naujv
      Junior Member
      • Jul 2010
      • 6

      #3
      Hi litati,

      I just tried using maq on my 454 data. What I'm seeing from the alignment (maq mapview all.map > $someoutputfile) are my sequences are being cut off at 34 nts.

      Comment

      • krobison
        Senior Member
        • Nov 2007
        • 734

        #4
        Try bwasw (a mode of bwa)

        Comment

        • jgibbons1
          Senior Member
          • Oct 2009
          • 135

          #5
          I'm pretty sure MAQ can only map reads 63bp or smaller.

          Comment

          • Naujv
            Junior Member
            • Jul 2010
            • 6

            #6
            krobison, thanks! I appreciate your input.

            Took your advice and tried bwasw, but sort of ran into a problem with my alignments. My CIGAR string has "S" in them. Found another post where I guess there's a problem with the CIGAR ??

            If you have time, I would like your thoughts (and others) regarding using bwasw for reference sequences (not whole genome and not whole chromosomes). Mine are made up of 100 non-overlapping sequences in fasta format.

            Comment

            • nilshomer
              Nils Homer
              • Nov 2008
              • 1283

              #7
              Originally posted by Naujv View Post
              krobison, thanks! I appreciate your input.

              Took your advice and tried bwasw, but sort of ran into a problem with my alignments. My CIGAR string has "S" in them. Found another post where I guess there's a problem with the CIGAR ??

              If you have time, I would like your thoughts (and others) regarding using bwasw for reference sequences (not whole genome and not whole chromosomes). Mine are made up of 100 non-overlapping sequences in fasta format.
              The "S" character indicates soft-clipping, which is described in the SAM specification. If you still think it is a bug, could you post the SAM record in question?

              Comment

              • Naujv
                Junior Member
                • Jul 2010
                • 6

                #8
                nils thanks for the help! i'm new (as in today new) to bwa. it may not be an error/bug, though i tried to look where the alignment is, i couldn't find it. the sequence looks like one big ugly repeat, so maybe this is spurrious. maybe you can help me understand what 40 in the line is? mapping quality? where does good and bad lie?

                GKTESVC03GKDWH 16 ref|NG_023054.1|:5000-113024 77792 40 46S48M143S * 0 0 ATTCCATTCCATTCCATTCGGTTTNAACGGTATTCCAATCGATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCTTTCCATTCCATTACGGATGATTCCATTCCATTGCATTCCATTCCATTCCATTCCCCTGTACTCGGGTTGATTCCATTCCATTCCATTCCAATCCATGCCATTCCACTCGTGTTGATTCCATTCTTTCCATTCCATTCAAGTTGATTCCATTCCAT .199;:992131111:.,.--,,,!--.--17995566999:=BBABBBBBDDDAAA????DAAAAADBBBAA>=<900000..22:;9;;<62444444<<==>=>>>>>AB===A?????DDDDFFDDFFFF;;99<??@@<<44488ABBBBDDDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFHFDCCCFFFF888CCGFFFFGDFFFFC??@A????FCCDDHF
                AS:i:44 XS:i:0 XF:i:2 XE:i:6 XN:i:0

                Comment

                • nilshomer
                  Nils Homer
                  • Nov 2008
                  • 1283

                  #9
                  Originally posted by Naujv View Post
                  nils thanks for the help! i'm new (as in today new) to bwa. it may not be an error/bug, though i tried to look where the alignment is, i couldn't find it. the sequence looks like one big ugly repeat, so maybe this is spurrious. maybe you can help me understand what 40 in the line is? mapping quality? where does good and bad lie?

                  GKTESVC03GKDWH 16 ref|NG_023054.1|:5000-113024 77792 40 46S48M143S * 0 0 ATTCCATTCCATTCCATTCGGTTTNAACGGTATTCCAATCGATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCTTTCCATTCCATTACGGATGATTCCATTCCATTGCATTCCATTCCATTCCATTCCCCTGTACTCGGGTTGATTCCATTCCATTCCATTCCAATCCATGCCATTCCACTCGTGTTGATTCCATTCTTTCCATTCCATTCAAGTTGATTCCATTCCAT .199;:992131111:.,.--,,,!--.--17995566999:=BBABBBBBDDDAAA????DAAAAADBBBAA>=<900000..22:;9;;<62444444<<==>=>>>>>AB===A?????DDDDFFDDFFFF;;99<??@@<<44488ABBBBDDDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFHFDCCCFFFF888CCGFFFFGDFFFFC??@A????FCCDDHF
                  AS:i:44 XS:i:0 XF:i:2 XE:i:6 XN:i:0
                  Have a real close read of the SAM specification. You will be going back to this quite a bit. The 5th column is the PHRED-scaled mapping quality. Looking at the CIGAR field (6th column), "46S48M143S", there seems to be 48 bases matching your reference, with the first 46 and last 143 soft-clipped.

                  Comment

                  • Naujv
                    Junior Member
                    • Jul 2010
                    • 6

                    #10
                    Thank you! Going through 2008 MAQ paper now.

                    Comment

                    • geschickten
                      Member
                      • Jul 2009
                      • 31

                      #11
                      Hi All,

                      We have a MAQ that works with 125bp Illumina read and we also a version that works with 454 data. Its not in open domain. If anybody is interested then please send me a request at [email protected]. Thanks.

                      Comment

                      Latest Articles

                      Collapse

                      • SEQadmin2
                        How Immunogenomics Decodes Immunity’s Genetic Blueprint
                        by SEQadmin2




                        The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                        This convergence of genetics, immunology, and computation...
                        Today, 05:41 AM
                      • SEQadmin2
                        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                        by SEQadmin2



                        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                        Despite this, “CRISPR helped turn genome editing from a specialized technique into
                        ...
                        07-31-2026, 11:01 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by SEQadmin2, 08-24-2026, 10:32 AM
                      0 responses
                      39 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-20-2026, 11:17 AM
                      0 responses
                      45 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-18-2026, 10:05 AM
                      0 responses
                      51 views
                      0 reactions
                      Last Post SEQadmin2  
                      Started by SEQadmin2, 08-13-2026, 12:22 PM
                      0 responses
                      49 views
                      0 reactions
                      Last Post SEQadmin2  
                      Working...