Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Trimmomatic but no trimming

    Hii dear friends

    I have a question about Trimmomatic. I wrote this command:

    java -jar /usr/bin/trimmomatic-0.33.jar PE -phred64 72_L3_1.fq.gz 72_L3_2.fq.gz 71P_1.fq.gz 71UP_1.fq.gz 71P_2.fq.gz 71UP_2.fq.gz ILLUMINACLIP:Over.fasta:2:40:15


    72_L3_1.fq.gz
    and
    72_L3_2.fq.gz
    are my input files

    71P_1.fq.gz
    71UP_1.fq.gz
    71P_2.fq.gz
    and
    71UP_2.fq.gz
    are my output files. In my case P means paired and UP means unpaired.

    after I did fastqc I got overrepresented sequence (it is not adapter) and I stored it in Over.fasta and I want to trim it from my data.

    but when I run the command I see this:

    ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
    Input Read Pairs: 19759652 Both Surviving: 19759652 (100.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%)

    It does not trim the sequence.

    Why it is like that?

    In addition, for Palindrome and Single mode U just selected 40 and 15 because the manual selected them. Actually I do not know which score I should select. How can I choose the correct score?

    Would you please help me in these two questions.

    -------------------------------------------------------------------
    I'm sorry for asking so many questions each day. I' working with RNA-seq data in these days. In each level, I should stop due to errors, warnings, blocks and confusions and this story continues.

    and thank you for helping me in solving all these problems.

  • #2
    Are you sure nothing was done the your sequences? 100% reads surviving does not necessarily mean no trimming was performed, especially when you don't specify MINLEN.

    Comment


    • #3
      Yes, I'm almost sure because when I do fastqc, the number of reads and nucleotides in them have not changed (I mean "Total sequences" and "Sequence length").

      Comment


      • #4
        Originally posted by Saeideh View Post
        ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
        The explanation is here (highlighted in red). Trimmomatic is not finding any valid sequences to use for trimming in the supplied clipping file 'Over.fasta' meaning you must have formatted it incorrectly.

        Comment


        • #5
          I put following sequences in Over.fasta

          CTCCCATTTCGCTCGCCGCTACTACGGGAATCGCTTTTGCTTTCTTTTCC
          GGCTTGCGGTGGATACCTAGGTACCCAGAGACGAGGAAGGGCGTAGCAAG

          Isn't it correct?

          Comment


          • #6
            That is not a valid fasta file.

            https://en.wikipedia.org/wiki/FASTA_format

            Comment


            • #7
              Alriiiiiight...

              I got it

              Thanks all

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Advanced Tools Transforming the Field of Cytogenomics
                by seqadmin


                At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
                09-26-2023, 06:26 AM
              • seqadmin
                How RNA-Seq is Transforming Cancer Studies
                by seqadmin



                Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
                09-07-2023, 11:15 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 09-29-2023, 09:38 AM
              0 responses
              10 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 09-27-2023, 06:57 AM
              0 responses
              13 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 09-26-2023, 07:53 AM
              0 responses
              30 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 09-25-2023, 07:42 AM
              0 responses
              18 views
              0 likes
              Last Post seqadmin  
              Working...
              X