Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • cutadapt questions on pair-end seqeuencing data

    I'm trying to use cutadapt to trim my data. The adaptor sequences from Illumina only has a universal adapter, then one sequence for each index.
    Example here:
    TruSeq Universal Adapter
    5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
    TruSeq Adapter, Index 1 5
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
    TruSeq Adapter, Index 2
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG
    TruSeq Adapter, Index 3
    5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG

    When I read the guide from cutadapt for pair-end data, they suggest a file named ADAPTER_FWD (should be trimmed from the forward reads (filename.1.fastq.gz) and a file named ADAPTER_REV from the reverse reads (filename.2.fastq.gz).
    So my question is: What sequence do I put in ADAPTER_FWD, and what sequence in ADAPTER_REV?


    The command is:
    cutadapt -a ADAPTER_FWD -A ADAPTER_REV -o out.1.fastq -p out.2.fastq reads.1.fastq reads.2.fastq

  • #2
    Another related question here:
    My sequencing center said they didn't trimmed any adapters. So I went to the fastq.gz files, and grep the adapter sequence for the first 1 million reads, I only have 10442 hits. I wonder why the hits number is so small? Does that mean 989,558 reads are shorter and without the adapters?
    Thanks!

    Comment


    • #3
      Most sequences will be shorter than full length, and/or contain errors, and thus not match exactly with grep.

      I recommend you use BBDuk for adapter trimming, using the command at the top of the post.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Recent Advances in Sequencing Analysis Tools
        by seqadmin


        The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
        05-06-2024, 07:48 AM
      • seqadmin
        Essential Discoveries and Tools in Epitranscriptomics
        by seqadmin




        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
        04-22-2024, 07:01 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 05-14-2024, 07:03 AM
      0 responses
      20 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-10-2024, 06:35 AM
      0 responses
      44 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-09-2024, 02:46 PM
      0 responses
      54 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 05-07-2024, 06:57 AM
      0 responses
      42 views
      0 likes
      Last Post seqadmin  
      Working...
      X