Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • xiefanfang@gmail.com
    Junior Member
    • Sep 2012
    • 8

    How to create an amplicon reference for Bismark analysis

    I am working with a Miseq dataset on multiplex bisulfite amplicon sequencing. I have the sequences of the 30 amplicons. How can I make a fasta reference out of them to be used for Bismark alignment?
    I have made a fasta file listing the amplicons as the following, but it didn't work with Bismark. I got 0% CpG methylation and 99% CHH methylation. Is there anything wrong with my amplicon reference? Thank you!

    >Myh6_1
    AATAACTGAGGTAAGGGCCTGGGTAGGGGAGGTGGTGTGAGACGCTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCATGGAGCCAGAGGGGCGAGGGCAACAGACCTTTCATGGGCAAACCTTGGGGCCCTGCTGTCCTCCTGTCACCTCCAGAGCCAAGGGATCAAAGGAGGAGGAGCCAGGACAGGAGGGAAGTGGGAGGGAGGGTCCCAGCAGAGGACTCCAAATTTAGGCAGCAGGCATATGGGATGGGATATAAAGGGGCTGGAGCACTGAGAGCTGTCAGACAGAGATTTCTCCAACCCAGGTAAGAGGGAGTTTCGGGTGGGGGCTCTTCACCCACACCAGACCTCTCCCCACCTAGAAGGAAACTGCCTTTCCTGGAAGT
    >Myh6_2
    CCTCCCATCAGGAGTGGAGGGTTGCAGAGGGAGGGTAAAAACCTACATGTCCAAACATCATGGTGCACGATATATGGATCAGTATGTGTAGAGGCAAGAAAGGAAATCTGCAGGCTTAACTGGGTTAATGTGTAAAGTCTGTGTGCATGTGTGTGTGTCTGACTGAAAACGGGCATGGCTGTGCAGCTGTTCAGTTCTGTGCGTGAGGTTACCAGACTGCAGGTTTGTGTGTAAATTGCCCAAGGCAAAGTGGGTGAATCCCTTCCATGGTTTAAAGAGATTGGATGATGGCCTGCATCTCAGGGACCATGGAAAATAGAATGGACACTCTATATGTGTCCCTAAGCCAAGGTAGCAAGGTCTTTGGAGGAC
    >Myh7_1
    GCTCAGAGCTGTGTTTGGGAAGAAAGGGGATTTCAAACTAAACCCTGAGTCTGTTGCCTAGACACCGAGCAGTGAAGCTTCTATAGCTGGAAGAACAAGAACGAGGCTGGGTGCCAGCGTTGCTCCCGGGGCCTGCAGGGGAAGACAAGGTCTCTCCTGTCCTGTCCCTCTCTCCACTAGGAAGAACAAAGATTGCACCCACGGCTAGACAGAGGCCAGGTGGACCAGGCAGCCGTAGCCATATCATCTACAGCCCTGGGTAACCCTGGGAGGCTCAGGCCTTGCGCCTCGAAAATCTGCAGGGCAGCGCTAGAACAGGAAAGGGCTCTAAAGCAGGACCATGAGCAACTGGTCCTCCTCCCCAAACAGCTTTGGCATACTTCTTAGCATCCCTAGCCCTCCTCCCCTGATTGGGATCAACTTCCTATCTGCTG
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    When you get weird results it's always best to first look at the BAM files in IGV. Do the alignments look reasonable? Do they support the results? This will typically resolve residual doubts.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM
    • SEQadmin2
      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
      by SEQadmin2



      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
      ...
      07-09-2026, 11:10 AM
    • SEQadmin2
      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
      by SEQadmin2



      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
      07-08-2026, 05:17 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 07-20-2026, 11:10 AM
    0 responses
    18 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-13-2026, 10:26 AM
    0 responses
    33 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-09-2026, 10:04 AM
    0 responses
    44 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-08-2026, 10:08 AM
    0 responses
    30 views
    0 reactions
    Last Post SEQadmin2  
    Working...