Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How to create an amplicon reference for Bismark analysis

    I am working with a Miseq dataset on multiplex bisulfite amplicon sequencing. I have the sequences of the 30 amplicons. How can I make a fasta reference out of them to be used for Bismark alignment?
    I have made a fasta file listing the amplicons as the following, but it didn't work with Bismark. I got 0% CpG methylation and 99% CHH methylation. Is there anything wrong with my amplicon reference? Thank you!

    >Myh6_1
    AATAACTGAGGTAAGGGCCTGGGTAGGGGAGGTGGTGTGAGACGCTCCTGTCTCTCCTCTATCTGCCCATCGGCCCTTTGGGGAGGAGGAATGTGCCCAAGGACTAAAAAAAGGCCATGGAGCCAGAGGGGCGAGGGCAACAGACCTTTCATGGGCAAACCTTGGGGCCCTGCTGTCCTCCTGTCACCTCCAGAGCCAAGGGATCAAAGGAGGAGGAGCCAGGACAGGAGGGAAGTGGGAGGGAGGGTCCCAGCAGAGGACTCCAAATTTAGGCAGCAGGCATATGGGATGGGATATAAAGGGGCTGGAGCACTGAGAGCTGTCAGACAGAGATTTCTCCAACCCAGGTAAGAGGGAGTTTCGGGTGGGGGCTCTTCACCCACACCAGACCTCTCCCCACCTAGAAGGAAACTGCCTTTCCTGGAAGT
    >Myh6_2
    CCTCCCATCAGGAGTGGAGGGTTGCAGAGGGAGGGTAAAAACCTACATGTCCAAACATCATGGTGCACGATATATGGATCAGTATGTGTAGAGGCAAGAAAGGAAATCTGCAGGCTTAACTGGGTTAATGTGTAAAGTCTGTGTGCATGTGTGTGTGTCTGACTGAAAACGGGCATGGCTGTGCAGCTGTTCAGTTCTGTGCGTGAGGTTACCAGACTGCAGGTTTGTGTGTAAATTGCCCAAGGCAAAGTGGGTGAATCCCTTCCATGGTTTAAAGAGATTGGATGATGGCCTGCATCTCAGGGACCATGGAAAATAGAATGGACACTCTATATGTGTCCCTAAGCCAAGGTAGCAAGGTCTTTGGAGGAC
    >Myh7_1
    GCTCAGAGCTGTGTTTGGGAAGAAAGGGGATTTCAAACTAAACCCTGAGTCTGTTGCCTAGACACCGAGCAGTGAAGCTTCTATAGCTGGAAGAACAAGAACGAGGCTGGGTGCCAGCGTTGCTCCCGGGGCCTGCAGGGGAAGACAAGGTCTCTCCTGTCCTGTCCCTCTCTCCACTAGGAAGAACAAAGATTGCACCCACGGCTAGACAGAGGCCAGGTGGACCAGGCAGCCGTAGCCATATCATCTACAGCCCTGGGTAACCCTGGGAGGCTCAGGCCTTGCGCCTCGAAAATCTGCAGGGCAGCGCTAGAACAGGAAAGGGCTCTAAAGCAGGACCATGAGCAACTGGTCCTCCTCCCCAAACAGCTTTGGCATACTTCTTAGCATCCCTAGCCCTCCTCCCCTGATTGGGATCAACTTCCTATCTGCTG

  • #2
    When you get weird results it's always best to first look at the BAM files in IGV. Do the alignments look reasonable? Do they support the results? This will typically resolve residual doubts.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Best Practices for Single-Cell Sequencing Analysis
      by seqadmin



      While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
      06-06-2024, 07:15 AM
    • seqadmin
      Latest Developments in Precision Medicine
      by seqadmin



      Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

      Somatic Genomics
      “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
      05-24-2024, 01:16 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 06-21-2024, 07:49 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-20-2024, 07:23 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-17-2024, 06:54 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-14-2024, 07:24 AM
    0 responses
    25 views
    0 likes
    Last Post seqadmin  
    Working...
    X