[robs]

If you take a look at the error message, it tells you why: "No alias or index file found for nucleotide database [nr]". The NR database is a protein database. What you probably want is NT.

[horvathdp]

problems with stand alone blast to nr

Hi all. I downloaded blast, and can make it work fine when I blast one data set against another (after formatting them) , but I can't seem to get the program to do a blast against the nr database that I downloaded and unpacked. My command lines is: blastn -query C:\Users\horvathd\Desktop\DREB.fa -db nr -out C:\Users\horvathd\Desktop\Dreb_vs_nr.txt -evalue 1e-5 -num_alignments 20 -outfmt 0 -num_descriptions 20

I get the following error

BLAST Database error: No alias or index file found for nucleotide database [nr]
in search path [C:\Program Files\NCBI\blast-2.2.24+\bin;;]

I unpacked the nr files in the "bin" folder. I can blast the DREB.fa file against other databases I have created with no problem. Any idea what I am doing wrong?

[maubp]

Yes, that's correct. But the output file generated is of random pattern which makes it more difficult for me to extract only aligned regions. Below if the example of the file.

Please let me know if anyone knows how to deal with this. Thank you!

BioPerl has a parser for this (the default plain text output from BLAST). You can also tell BLAST to output simple tabular data, or XML. Lots of options.

[BioTalk]

Just to clarify - you're getting the one alignment that you want, but you're also getting the "No hits found" ones too?
If that's the case, you could use BioPerl to go through the file and then choose to only print out the ones that have hits to a new file.

Yes, that's correct. But the output file generated is of random pattern which makes it more difficult for me to extract only aligned regions. Below if the example of the file.

Please let me know if anyone knows how to deal with this. Thank you!

BLASTN 2.2.23+


Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A.
Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.
Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs", Nucleic Acids Res. 25:3389-3402.



Database: Desktop/RNA.fa
15,632 sequences; 339,921 total letters



Query= 1-72342
Length=20


***** No hits found *****



Lambda K H
0.634 0.408 0.912

Gapped
Lambda K H
0.625 0.410 0.780

Effective search space used: 956935


Query= 2-55421
Length=19


***** No hits found *****



Lambda K H
0.634 0.408 0.912

Gapped
Lambda K H
0.625 0.410 0.780

Effective search space used: 1066359


Query= 3-46574
Length=21
Score E
Sequences producing significant alignments: (Bits) Value



>lcl|zma-miR159k MIMAT0013980 Zea mays miR159k
Length=21

Score = 39.2 bits (42), Expect = 1e-06
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus

Query 1 TTTGGATTGAAGGGAGCTCTG 21
|||||||||||||||||||||
Sbjct 1 TTTGGATTGAAGGGAGCTCTG 21


>lcl|
MIMAT0013979 Zea mays miR159j
Length=21

Score = 39.2 bits (42), Expect = 1e-06
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus

Query 1 TTTGGATTGAAGGGAGCTCTG 21
|||||||||||||||||||||
Sbjct 1 TTTGGATTGAAGGGAGCTCTG 21


>lcl|zma-miR159f MIMAT0013975 Zea mays miR159f
Length=21

Score = 39.2 bits (42), Expect = 1e-06
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus

Query 1 TTTGGATTGAAGGGAGCTCTG 21
|||||||||||||||||||||
Sbjct 1 TTTGGATTGAAGGGAGCTCTG 21


>lcl|tae-miR159b MIMAT0005344 Triticum aestivum miR159b
Length=21

Score = 39.2 bits (42), Expect = 1e-06
Identities = 21/21 (100%), Gaps = 0/21 (0%)
Strand=Plus/Plus

Query 1 TTTGGATTGAAGGGAGCTCTG 21
|||||||||||||||||||||
Sbjct 1 TTTGGATTGAAGGGAGCTCTG 21

[rglover]

Just to clarify - you're getting the one alignment that you want, but you're also getting the "No hits found" ones too?
If that's the case, you could use BioPerl to go through the file and then choose to only print out the ones that have hits to a new file.

[BioTalk]

If you use this command you'll only get the alignments:
-num_descriptions 0 -num_alignments <however-many-you-want>

You'll still get an output for the sequences where no matches have been found though. You could also try using BioPerl to process the Blast results.

I tried -num_descriptions 0 -num_alignment 1 -outfmt 0, but I am still getting all the matched and unmatched regions in the same file.

[rglover]

If you use this command you'll only get the alignments:
-num_descriptions 0 -num_alignments <however-many-you-want>

You'll still get an output for the sequences where no matches have been found though. You could also try using BioPerl to process the Blast results.

[BioTalk]

Does anyone know how to get an output file in Blast with only the details of aligned regions?

Because I am trying to compare two files with any fasta sequences in it and I am getting huge file with match as well as not matched regions.

[robs]

If you expect errors in your sequences or want to look for more distant relationships, you might want to lower the seed length (default of 11; try 6-8; parameter -W). BLAST(+) also filters regions for low complexity and your short sequences might be filtered out before any alignment. You can turn off the filtering and see if it makes any differences (-nofilter).

[westerman]

For short sequences and for blast+ then using the commands 'blastn-short' or 'megablast' will be preferable to the regular commands. If those commands are not directly available then run 'blastn' with the command line option '-task blastn-short' or '-task megablast'.

There may be other options that I am unaware of since I do not do many short sequence alignments. The most important concept is to simply be aware that blast is generally used to align longer sequence and that at 20-bp you are getting close to the window sizes that blast uses. Blast, like many tools, is not something to use without some thought.

[BioTalk]

Also it looks like your query sequences are very short (20 bp). You will probably have take this into consideration via non-default command line parameters.

Yes, my query sequences are shorter than 20bp. What non default commands do I need to use?

[westerman]

Also it looks like your query sequences are very short (20 bp). You will probably have take this into consideration via non-default command line parameters.

[BioTalk]

Thanks to you! Sure I will have look into blast+ manual.

[rglover]

if you have a look in the blast+ manual there's some formatting guidelines for tabulating the data output etc. Glad you got it working!

[BioTalk]

Thank you all very much! Now, I am able to generate following type of Blast output file:
Which is a huge file because of the repetition of the information. Does anyone know how can we get it in any other format?

BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= 1-72342
(20 letters)

Database:/home//Desktop/mma.faa
15,632 sequences; 339,921 total letters

Searching..................................................done

***** No hits found ******


BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= 2-55421
(19 letters)

Database: /home//Desktop/mma.fa
15,632 sequences; 339,921 total letters

Searching..................................................done

***** No hits found ******


BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= 3-46574
(21 letters)

Database: /home/Desktop/mma.fa
15,632 sequences; 339,921 total letters

Searching..................................................done

***** No hits found ******


BLASTN 2.2.21 [Jun-14-2009]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= 4-38013
(17 letters)

Database: /home//Desktop/mma.fa
15,632 sequences; 339,921 total letters

Searching..................................................done

***** No hits found ******