what does this bowtie error information mean?

[zxybl]

I ran bowtie with default parameter. there was an error information:

Reads file contained a pattern with more than 1024 sequence characters.
Please truncate reads and quality values and re-run Bowtie.
Offending read: AIAE-aaa09g07.g1
Command: bowtie -f can20100804 ../cDNA/ALL_input_reads. clean.contam_free.min_size_50bp.pruned_headers.fna

what does it mean? How can I truncate the reads?

Thanks,
xu

[zxybl]

I think this is the answer:
it supports arbitrarily small reference sequences (e.g. amplicons) and reads as long as 1024 bases
I will check my reads.

[pepperoni]

I get the same error and I am sure my longest read is 55bp. What does that mean? how can I solve it? Actually if I convert the fastq file to fasta and run Bowtie it does work with the fasta. I have also got rid of all the reads that contained dots.

[Sinha_Ashis]

Same error cant find solution

Hello everyone,

My name is Ashis. I am quite new here. I run bowtie as well and am getting the same error,

Reads file contained a pattern with more than 1024 quality values
Please truncate reads and quality values and and re-run Bowtie

my friends advised me to get rid of the . (dots) in the reads. but how do I do that, I tried using fastx_clipper but then I get an error

fastx_clipper: found invalid nucleotide sequence (GTTTCTGATGGATTAGTGGAGAAAACAGAAAATTCTGAGTA#&%%) on line 14364670

the special characters after AAAATTCTGAGTA ie #&%% are not coming out right


please help

Ashis

[zxybl]

I did not use fastx_clipper. but you can just use a command(such as sed,perl) to remove them. and I think you also need to remove all these characters and make sure the sequence length is less than 1024.

Good luck

Hello everyone,

My name is Ashis. I am quite new here. I run bowtie as well and am getting the same error,

Reads file contained a pattern with more than 1024 quality values
Please truncate reads and quality values and and re-run Bowtie

my friends advised me to get rid of the . (dots) in the reads. but how do I do that, I tried using fastx_clipper but then I get an error

fastx_clipper: found invalid nucleotide sequence (GTTTCTGATGGATTAGTGGAGAAAACAGAAAATTCTGAGTA#&%%) on line 14364670

the special characters after AAAATTCTGAGTA ie #&%% are not coming out right


please help

Ashis