Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • trim adapter from Illumina Genome Analyzer IIe miRNA reads

    Hi everybody,

    I can't find the sequence of the adapter from Illumina's Genome Analyzer II. I've received reads ( 36 nt each sequence ) to detect new miRNA from an ovin model.

    I've found the function trimLRPatterns in R but I need the sequence to trim.

    Can someone help me

    Thanks a lot,

    N.

  • #2
    nobody knows ?

    it will help me a lot.

    Thanks

    Comment


    • #3
      Originally posted by NicoBxl View Post
      nobody knows ?

      it will help me a lot.

      Thanks
      You can try clipRead program at our deepBase database ( http://deepbase.sysu.edu.cn/ ), which were developed to discover small and long ncRNAs from deep-sequencing data.

      you can download clipRead program at http://deepbase.sysu.edu.cn/clipRead/. More detailed information, please see the readme file ( http://deepbase.sysu.edu.cn/clipRead/readme.txt ).
      Last edited by yjhua2110; 08-09-2010, 07:47 AM.

      Comment


      • #4
        See
        http://seqanswers.com/forums/showthread.php?t=198&highlight=sticky


        It should be a sticky but doesn't "stick" to the top

        Comment


        • #5
          thanks, I found the adapter I expect

          3'RNA adapter : UCGUAUGCCGUCUUCUGCUUGU

          In my fastq file, I've got about 19M reads. When I sort the reads on the number of occurences, I found that the sequence with the most important occurence is :

          adapter

          TCGTATGCCGTCTTCTGCTTGTAAAAAAAAAAAAAA (I remplace U by T)

          and the next sequence in the list are similar (It seems that one mismatch appears in the 3! part of the reads )

          I found some other reads with high occurence like that :

          adapter in green and a mismatch in the adapter seq in red

          TCGTATGCCGTCTTCTGCTTGTAAAAAAAAAAAAAA

          and even ( just a part of the adapter is present, the N represent an non-readable nucleotide )

          AGTACAGTCTCGTATGCCGTCTNNNNNNNNN

          the last example appears even with mismatches.

          what is the best method to trim this adapter ?

          Thanks

          Comment


          • #6
            hellö, I have the same problem now, then how did you deal with finally?

            Comment

            Latest Articles

            Collapse

            • seqadmin
              Latest Developments in Precision Medicine
              by seqadmin



              Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

              Somatic Genomics
              “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
              05-24-2024, 01:16 PM
            • seqadmin
              Recent Advances in Sequencing Analysis Tools
              by seqadmin


              The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
              05-06-2024, 07:48 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by seqadmin, 05-24-2024, 07:15 AM
            0 responses
            13 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-23-2024, 10:28 AM
            0 responses
            17 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-23-2024, 07:35 AM
            0 responses
            20 views
            0 likes
            Last Post seqadmin  
            Started by seqadmin, 05-22-2024, 02:06 PM
            0 responses
            10 views
            0 likes
            Last Post seqadmin  
            Working...
            X