Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Ben Langmead
    Senior Member
    • Sep 2008
    • 200

    #151
    Originally posted by ewingad View Post
    Would it also be valid use the -k 2 option and throw out reads for which two alignments are reported? This is slower than alignment against a masked genome but faster than -m 1.
    Absolutely, as long as you're using -k 2 in an unstratified reporting mode (the default in 0.10.0). Obviously, stratified -k 2 is not a good proxy for unstratified -m 1.

    I would be surprised if unstratified -k 2 performed all that differently from unstratified -m 1, since what's going on under the hood is essentially the same. Do you have an example where it is? If so, I should take a look.

    Ben

    Comment

    • ewingad
      Junior Member
      • Aug 2008
      • 6

      #152
      Originally posted by Ben Langmead View Post
      Absolutely, as long as you're using -k 2 in an unstratified reporting mode (the default in 0.10.0). Obviously, stratified -k 2 is not a good proxy for unstratified -m 1.

      I would be surprised if unstratified -k 2 performed all that differently from unstratified -m 1, since what's going on under the hood is essentially the same. Do you have an example where it is? If so, I should take a look.

      Ben
      Actually now that I benchmark it, -m 1 is slightly faster than -k 2 using 0.10.0.

      -Adam

      Comment

      • kcook
        Junior Member
        • Jun 2009
        • 2

        #153
        Hi all,

        I'm using Bowtie to map some RNA-seq data, and I wanted to clarify my understanding of a couple points.

        The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?

        Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?

        Thanks a lot, and I apologize if any of this is explained in the manual or otherwise obvious.

        Kate

        Comment

        • Ben Langmead
          Senior Member
          • Sep 2008
          • 200

          #154
          Hi Kate,

          Originally posted by kcook View Post
          Hi all,
          The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?
          Yes - that's all correct.

          Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?
          The quality ceiling only applies in the -n ("Maq-like") alignment mode. So your statement is still correct for -v 2, but it's also the case that in -v 3 mode, alignments with combined mismatch qualities exceeding 70 are valid.

          I hope that helps,
          Ben

          Comment

          • kcook
            Junior Member
            • Jun 2009
            • 2

            #155
            Great! Thanks for the quick reply.

            Comment

            • inesdesantiago
              Member
              • Jan 2009
              • 44

              #156
              Hello,

              Originally posted by kcook View Post
              Hi all,

              I'm using Bowtie to map some RNA-seq data, and I wanted to clarify my understanding of a couple points.

              The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?

              Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?

              Thanks a lot, and I apologize if any of this is explained in the manual or otherwise obvious.

              Kate
              kcook, you illuminated me! Now I anderstand the -m 1 better!

              Comment

              • chuck
                Member
                • Apr 2009
                • 13

                #157
                bowtie 'hanging'

                Ben,

                It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.

                SOLEXA8_38_8_100_1783_191_0_2/2 - Castanea 105274 GATCCGTATCATCTTGACTTGGTTCTGATTTCTCTATTTTTTTAAGAATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0
                SOLEXA8_38_8_100_1783_586_0_1/1 + Castanea 107330 CGTTACCTTAACCACAAGGAGGGGGATGCCGAAGGCAGGGCTAGTGACTGG IIIIII

                Originally posted by Ben Langmead View Post
                Hi Chuck,

                Please post the exact Bowtie version and arguments you're using. Also, please let me know if you see this problem when you use the latest version of Bowtie (0.10.0).

                Thanks,
                Ben
                I just downloaded the latest version last night (0.10.0.2).

                The job statement is as follows:

                ./bowtie -f Castmoll_cp -1 /media/upuna/LH0002/LH0002_302MJAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_1.fa -2 /media/upuna/LH0002/LH0002_302MJAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_2.fa /media/upuna/LH0002/LH2_all_castmoll.map

                Thanks,
                Chuck

                Comment

                • Ben Langmead
                  Senior Member
                  • Sep 2008
                  • 200

                  #158
                  Hi Chuck,

                  Originally posted by chuck View Post
                  Ben,

                  It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.
                  Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.

                  Thanks,
                  Ben

                  Comment

                  • chuck
                    Member
                    • Apr 2009
                    • 13

                    #159
                    Originally posted by Ben Langmead View Post

                    Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.
                    Ben,

                    I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

                    Chuck

                    Comment

                    • Ben Langmead
                      Senior Member
                      • Sep 2008
                      • 200

                      #160
                      Originally posted by chuck View Post
                      Ben,

                      I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

                      Chuck
                      Hi Chuck - sorry, just do 'make bowtie-debug' and that should create it.

                      Ben

                      Comment

                      • chuck
                        Member
                        • Apr 2009
                        • 13

                        #161
                        oops, my bad -

                        okay, it aborts very quickly using 'bowtie-debug'. Using 'bowtie', it almost finishes but seems to stop working as it approaches the end.

                        --results using 'debug' below

                        command>>> ./bowtie-debug -f Castmoll_cp -1 /media/upuna/TD0001/TD0001_3108EAAXX_7_1.fa -2 /media/upuna/TD0001/TD0001_3108EAAXX_7_2.fa /media/upuna/TD0001/TD1_all_castmoll_debug.map

                        RESULT>>>
                        Warning: Read (SOLEXA5_68_7_1_25_2044_0_1/1) is less than 3 characters long; skipping...
                        assert_gt: expected (0) > (0)
                        ebwt_search_backtrack.h:3265
                        bowtie-debug: ebwt_search_backtrack.h:3265: virtual void EbwtSeededRangeSourceDriver::setQueryImpl(PatternSourcePerThread*, Range*): Assertion `0' failed.
                        Aborted

                        Comment

                        • bogdan
                          Member
                          • Jul 2008
                          • 35

                          #162
                          Hi everyone.

                          I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
                          if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
                          (i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
                          be possible to see the score of the alignment and the differences in the score among multiple regions ?
                          In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?

                          thanks very much,

                          bogdan

                          Comment

                          • Ben Langmead
                            Senior Member
                            • Sep 2008
                            • 200

                            #163
                            Hi Bogdan,

                            Originally posted by Bogdan Tanasa View Post
                            I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
                            if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
                            (i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
                            be possible to see the score of the alignment and the differences in the score among multiple regions ?
                            In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?
                            I think your questions will be best answered by referring you to the reporting modes section of the manual, which includes some example invocations of Bowtie. Hope that helps,

                            Ben

                            Comment

                            • Ben Langmead
                              Senior Member
                              • Sep 2008
                              • 200

                              #164
                              Hi Chuck,

                              If you have the time, there's one more thing it would help to try: remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

                              Thanks for your patience,
                              Ben

                              Comment

                              • chuck
                                Member
                                • Apr 2009
                                • 13

                                #165
                                Originally posted by Ben Langmead View Post
                                remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

                                Thanks for your patience,
                                Ben
                                doing this now.

                                I wanted to say that you are the patient one. I know how much work this software development is, particularly in the open environment!

                                All the best,
                                Chuck

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 07:41 AM
                                0 responses
                                9 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...