[Ben Langmead]

Would it also be valid use the -k 2 option and throw out reads for which two alignments are reported? This is slower than alignment against a masked genome but faster than -m 1.

Absolutely, as long as you're using -k 2 in an unstratified reporting mode (the default in 0.10.0). Obviously, stratified -k 2 is not a good proxy for unstratified -m 1.

I would be surprised if unstratified -k 2 performed all that differently from unstratified -m 1, since what's going on under the hood is essentially the same. Do you have an example where it is? If so, I should take a look.

Ben

[ewingad]

Absolutely, as long as you're using -k 2 in an unstratified reporting mode (the default in 0.10.0). Obviously, stratified -k 2 is not a good proxy for unstratified -m 1.

I would be surprised if unstratified -k 2 performed all that differently from unstratified -m 1, since what's going on under the hood is essentially the same. Do you have an example where it is? If so, I should take a look.

Ben

Actually now that I benchmark it, -m 1 is slightly faster than -k 2 using 0.10.0.

-Adam

[kcook]

Hi all,

I'm using Bowtie to map some RNA-seq data, and I wanted to clarify my understanding of a couple points.

The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?

Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?

Thanks a lot, and I apologize if any of this is explained in the manual or otherwise obvious.

Kate

[Ben Langmead]

Hi Kate,

Hi all,
The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?

Yes - that's all correct.

Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?

The quality ceiling only applies in the -n ("Maq-like") alignment mode. So your statement is still correct for -v 2, but it's also the case that in -v 3 mode, alignments with combined mismatch qualities exceeding 70 are valid.

I hope that helps,
Ben

[kcook]

Great! Thanks for the quick reply.

[inesdesantiago]

Hello,

Hi all,

I'm using Bowtie to map some RNA-seq data, and I wanted to clarify my understanding of a couple points.

The behaviour of -m 1 with default (0.10.0) parameters will only report results for which there is only one alignment anywhere within the 2-mismatch limit, right? So if there is an alignment with one mismatch and one with two, nothing will be reported. And if --strata is on, then the one-mismatch alignment will be reported (as long as there is only a single alignment with one mismatch). Is that all correct?

Also, the rounding of quality values to between 10 and 30 means that there is no combination of two mismatches that give a total quality score of 70, so in effect the quality scores only affect the order of the results returned (which doesn't apply when -m 1 is on anyway). Have I got that right?

Thanks a lot, and I apologize if any of this is explained in the manual or otherwise obvious.

Kate

kcook, you illuminated me! Now I anderstand the -m 1 better!

[chuck]

bowtie 'hanging'

Ben,

It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.

SOLEXA8_38_8_100_1783_191_0_2/2 - Castanea 105274 GATCCGTATCATCTTGACTTGGTTCTGATTTCTCTATTTTTTTAAGAATAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 0
SOLEXA8_38_8_100_1783_586_0_1/1 + Castanea 107330 CGTTACCTTAACCACAAGGAGGGGGATGCCGAAGGCAGGGCTAGTGACTGG IIIIII

Hi Chuck,

Please post the exact Bowtie version and arguments you're using. Also, please let me know if you see this problem when you use the latest version of Bowtie (0.10.0).

Thanks,
Ben

I just downloaded the latest version last night (0.10.0.2).

The job statement is as follows:

./bowtie -f Castmoll_cp -1 /media/upuna/LH0002/LH0002_302MJAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_1.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_1.fa -2 /media/upuna/LH0002/LH0002_302MJAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_2_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_1_2.fa,/media/upuna/LH0002/LH0002_3151AAAXX_3_2.fa /media/upuna/LH0002/LH2_all_castmoll.map

Thanks,
Chuck

[Ben Langmead]

Hi Chuck,

Ben,

It still seems to be doing this. When I look at the *map file, it obviously ends without properly finishing, as you can see from the last line.

Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.

Thanks,
Ben

[chuck]

Could you try the same command but using 'bowtie-debug' instead of 'bowtie'? If possible, pick a set of parameters where (a) 'bowtie' hangs and (b) the run doesn't take very long.

Ben,

I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

Chuck

[Ben Langmead]

Ben,

I don't seem to have a ./bowtie-debug command - I made this from the source code on a 64-bit machine.

Chuck

Hi Chuck - sorry, just do 'make bowtie-debug' and that should create it.

Ben

[chuck]

oops, my bad -

okay, it aborts very quickly using 'bowtie-debug'. Using 'bowtie', it almost finishes but seems to stop working as it approaches the end.

--results using 'debug' below

command>>> ./bowtie-debug -f Castmoll_cp -1 /media/upuna/TD0001/TD0001_3108EAAXX_7_1.fa -2 /media/upuna/TD0001/TD0001_3108EAAXX_7_2.fa /media/upuna/TD0001/TD1_all_castmoll_debug.map

RESULT>>>
Warning: Read (SOLEXA5_68_7_1_25_2044_0_1/1) is less than 3 characters long; skipping...
assert_gt: expected (0) > (0)
ebwt_search_backtrack.h:3265
bowtie-debug: ebwt_search_backtrack.h:3265: virtual void EbwtSeededRangeSourceDriver::setQueryImpl(PatternSourcePerThread*, Range*): Assertion `0' failed.
Aborted

[bogdan]

Hi everyone.

I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
(i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
be possible to see the score of the alignment and the differences in the score among multiple regions ?
In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?

thanks very much,

bogdan

[Ben Langmead]

Hi Bogdan,

I would appreciate to have your comments on the following : when aligning the solexa reads with bowtie,
if a read aligns to multiple genomic regions, is the highest-scored location picked up in the final report
(i.e. when using --best option) ? And if a read aligns with the same score to multiple regions, would it
be possible to see the score of the alignment and the differences in the score among multiple regions ?
In this last scenario, a randomly picked location among the equally scored genomic locations is reported ?

I think your questions will be best answered by referring you to the reporting modes section of the manual, which includes some example invocations of Bowtie. Hope that helps,

Ben

[Ben Langmead]

Hi Chuck,

If you have the time, there's one more thing it would help to try: remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

Thanks for your patience,
Ben

[chuck]

remove the 'bowtie' binary and rebuild it using 'make EXTRA_FLAGS="-O1" bowtie', then re-run the problematic command using the new binary.

Thanks for your patience,
Ben

doing this now.

I wanted to say that you are the patient one. I know how much work this software development is, particularly in the open environment!

All the best,
Chuck