Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • chuck
    Member
    • Apr 2009
    • 13

    Ben,

    I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.

    Chuck

    Comment

    • seq_GA
      Senior Member
      • Feb 2009
      • 124

      How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.
      After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?
      Please clarify about buinding different chrmosomes of hg18.
      Thanks.

      Comment

      • Ben Langmead
        Senior Member
        • Sep 2008
        • 200

        Originally posted by chuck View Post
        I tried bowtie remade with extraflags but it just did the same thing. Would there be a log file somewhere or something in the map file? I can't seem to find any additional output.
        Chuck - I turned this into a sourceforge issue so that we can keep all relevant info in one place and not clutter the forum too much:



        I'll keep looking at this. Thanks for the details.

        Ben

        Comment

        • Ben Langmead
          Senior Member
          • Sep 2008
          • 200

          Originally posted by seq_GA View Post
          How to build index for human genome? Do we need to add individual chrmosomes one by one with the same index name. Pretty confused about this step.
          You can specify a comma-separated list of FASTA files as the input to bowtie-build. Example scripts that do this automatically (including the download step) are included in the 'scripts' subdirectory of the Bowtie package. E.g. scripts/make_h_sapiens_asm.sh

          Alternately, you can download a pre-built index from the Bowtie website.

          Originally posted by seq_GA View Post
          After building index, I have to start using bowtie aligner like ./bowtie .. with parameter rite?.
          Yes, that's right.

          Ben

          Comment

          • bioinfosm
            Senior Member
            • Jan 2008
            • 483

            Shaun or Ben,

            Did you guys get around this?

            Originally posted by ShaunMahony View Post
            Hi Ben,
            Here's one, but I can send you a whole file if you like:

            >Test:chr5:15656372:15656404
            CTGAGCAAGGGGACCCCAATGGAAAAGTTAGG

            This is aligned uniquely (and correctly) by most aligners, but is not aligned by Bowtie with the above arguments. I just noticed that when I remove the "-m 2" option, this read is aligned uniquely. This is counter-intuitive.

            What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.
            --
            bioinfosm

            Comment

            • Ben Langmead
              Senior Member
              • Sep 2008
              • 200

              Hi,

              Originally posted by bioinfosm View Post
              Shaun or Ben,

              Did you guys get around this?
              Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:

              What arguments do you recommend if I just want to report the unique alignments? I have been using -m 2.
              Why -m 2 instead of -m 1?
              I don't know myself why I've been using -m 2 instead of -m 1. I must have
              assumed at some stage that -m counted greater than or equal to.

              What definition of "unique" are you after? Is it (a) there are no other legal alignments period, or (b) there are no other legal alignments with the same number of mismatches as the best match? If (b), use --strata --best -m 1, rather than just -m 1.
              Is -k X guaranteed to report the lowest mismatch alignments first?
              Answer: yes, -k X --best will report the "best" alignments first.

              Ben

              Comment

              • bioinfosm
                Senior Member
                • Jan 2008
                • 483

                thanks Ben ..
                --
                bioinfosm

                Comment

                • seq_GA
                  Senior Member
                  • Feb 2009
                  • 124

                  Thanks Ben.

                  Comment

                  • seq_GA
                    Senior Member
                    • Feb 2009
                    • 124

                    Hi Ben,

                    I get to see different output from the following examples. Please let me know whether I am intrepretting correctly.

                    Code:
                    ./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gtctggcggcggcctggcggagcg
                    1+:<21,21852845,0>
                    Reported 1 alignments to 1 output stream(s)
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gtctggcggcggcctggcggagcg -p 5
                    0  +  chr22 21852845    GTCTGGCGGCGGCCTGGCGGAGCG        IIIIIIIIIIIIIIIIIIIIIIII 0
                    Reported 1 alignments to 1 output stream(s)
                    
                    
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 --concise -c gaccaacttgttcagcgccttgat -p 5
                    1+:<5,132749285,0>
                    Reported 1 alignments to 1 output stream(s)
                    []$ ./bowtie -a --best -v 2 ../Genome/hg18/hg18 -c gaccaacttgttcagcgccttgat -p 5
                    0  +  chr9  132749285   GACCAACTTGTTCAGCGCCTTGAT        IIIIIIIIIIIIIIIIIIIIIIII 0
                    Reported 1 alignments to 1 output stream(s)
                    In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

                    Please let me know.

                    Comment

                    • seq_GA
                      Senior Member
                      • Feb 2009
                      • 124

                      Originally posted by Ben Langmead View Post
                      Hi,



                      Shaun also wrote an email at the time, which I responded to. I should have copied it here but didn't. Here are the salient bits, updated to be relevant to the changes made in 0.10.0:



                      Answer: yes, -k X --best will report the "best" alignments first.

                      Ben
                      But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
                      Thanks

                      Comment

                      • Ben Langmead
                        Senior Member
                        • Sep 2008
                        • 200

                        Originally posted by seq_GA View Post
                        In both the above example, I tried using --concise as well as complete output format. And for the same sequence, even though it reports the same coordinates, ref_idx seems to be different for both the outputs.

                        Please let me know.
                        Hi seq_GA,

                        --concise rerports the reference according to its internal index, not its name. I.e., the '5' you're seeing is because internally, Bowtie identifies that chromosome as '5' (probably because when you built your index, it was the 6th sequence to be indexed; it's 0-based). If you ask for verbose (default) output and supply the --refidx option with your second input, you should also see '5' in the ref_id column.

                        Hope that makes sense,
                        Ben

                        Comment

                        • Ben Langmead
                          Senior Member
                          • Sep 2008
                          • 200

                          Originally posted by seq_GA View Post
                          But is if enough for me to use only -m 1 just to extract uniquely aligned hits allowing 2 mismatch as -v 2 ?
                          Thanks
                          If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

                          Ben

                          Comment

                          • seq_GA
                            Senior Member
                            • Feb 2009
                            • 124

                            Originally posted by Ben Langmead View Post
                            If you supply '-v 2 -m 1', Bowtie will report an alignment only for reads having 1 legal alignment, regardless of stratum. I.e., if a read has a 1-mismatch alignment and a 2-mismatch alignment, no alignments will be reported for that read. And if a read has just a 2-mismatch alignment, then that alignment will be reported. This is in contrast to stratified mode ('--best --strata'), where the best alignment would be reported in both cases.

                            Ben
                            Hi Ben,
                            Thanks for the clarification. It is still bit confusing. If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?

                            I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?

                            Regards

                            Comment

                            • Ben Langmead
                              Senior Member
                              • Sep 2008
                              • 200

                              Originally posted by seq_GA View Post
                              Hi Ben,
                              If I mention '-v 2 -m 1', then one alignment with 2 mismatches (condition) will only be reported?
                              If you supply -m 1, Bowtie will suppress alignments for reads with more than 1 valid alignment.

                              Originally posted by seq_GA View Post
                              I want to find only uniquely aligned reads with atmost 2 mismatches in the seed. My read length is 36bps. How do I set the parameters?
                              You must pick a definition of "unique." If "unique" = there are no other alignments with the same number of mismatches, then use '--best -strata -m 1', (along with your alignment policy, e.g. '-v 2'). If "unique" = there are no other valid alignments period, then use '-m 1'. The former is stratified, the latter is unstratified.

                              Ben

                              Comment

                              • apostrophe
                                Junior Member
                                • Jul 2009
                                • 2

                                Sorry if this has been answered before, but does Bowtie support FASTA nucleic acid codes that code for two bases, such as Y = T or C for the genome? Thanks in advance.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                                  by SEQadmin2


                                  Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                                  The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                                  ...
                                  Yesterday, 10:05 AM
                                • SEQadmin2
                                  Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
                                  by SEQadmin2


                                  With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


                                  Introduction

                                  Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
                                  05-22-2026, 06:42 AM
                                • SEQadmin2
                                  Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
                                  by SEQadmin2

                                  Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


                                  Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
                                  05-06-2026, 09:04 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 12:03 PM
                                0 responses
                                19 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, Yesterday, 11:40 AM
                                0 responses
                                14 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 05-28-2026, 11:40 AM
                                0 responses
                                29 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 05-26-2026, 10:12 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...