Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • bio_tt
    Junior Member
    • May 2010
    • 9

    #346
    hi,
    bowtie is very popular,but i am a newer.and you say"Includes tool to convert Bowtie output to a Maq .map file ",but i don't know how to write the command line?could you help me? thanks

    Comment

    • gen2prot
      Member
      • Apr 2010
      • 68

      #347
      Hello Ben,

      I have a question with Bowtie. Does the bowtie-build command create a different index everytime it is run on the same data? Myself and my colleague are creating an index of the Drosophila genome. But he says that the builds are different everytime one runs it. Is this true? If so how is the downstream process (Tophat, Cufflinks) outputs comparable to each other.

      Thanks
      Abhijit

      Comment

      • Ben Langmead
        Senior Member
        • Sep 2008
        • 200

        #348
        Originally posted by gen2prot View Post
        I have a question with Bowtie. Does the bowtie-build command create a different index everytime it is run on the same data? Myself and my colleague are creating an index of the Drosophila genome. But he says that the builds are different everytime one runs it. Is this true? If so how is the downstream process (Tophat, Cufflinks) outputs comparable to each other.
        Hi gen2prot,

        If you run Bowtie twice on the same exact set of fasta files (same sequence names and sequence characters), specified in the same exact order, you should get the same exact index. If you don't, there's something wrong. If you have an example where it doesn't (the smaller the better), please email me.

        Thanks,
        Ben

        Comment

        • miltron
          Junior Member
          • May 2010
          • 3

          #349
          Hi, I'm a new member and I'm trying to use Bowtie to align some ChIPseq data. First of all, I'm really grateful that you are putting your efforts into this and really keeping an eye on this board it seems.

          I installed Bowtie binaries for Windows on my Windows 7 system and I'm trying to use Cygwin to run it. I have 4GB of RAM installed on this computer. According to the documentation I thought that should have been appropriate memory for my purpose, but I might be understanding.

          I'm assembling reads from 2.5 GB file to Mouse mm9 assembly and using the pre-built indexes reccommended in the Bowtie manual.

          However, when I run bowtie I get the following error message:

          Time loading forward index: 00:00:14
          Out of memory allocating the ebwt[] array for the Bowtie index. Please try
          again on a computer with more memory.
          Time loading mirror index: 00:00:01
          Time searching: 00:00:15
          Overall time: 00:00:15
          Command: C:\users\erna\desktop\bowtie-0.12.5-win32\bowtie-0.12.5\bowtie.exe -t -
          m 1 -v 2 -q --best mm9 reads/seq3.fastq seq3align.map


          I've tried to increase the memory allocated to Cygwin to no avail. Do you think that finding another Windows system with more memory will help?
          Thanks!

          Comment

          • Ben Langmead
            Senior Member
            • Sep 2008
            • 200

            #350
            Hi Miltron,

            I would recommend trying --offrate 6 and, if that doesn't work, --offrate 7. Those will use a sparser sample of the suffix array than is included in the index by default, which in turn reduces memory footprint. If that doesn't work, I would suggest running on a computer with more memory. The mouse genome is big

            Good luck,
            Ben

            Comment

            • miltron
              Junior Member
              • May 2010
              • 3

              #351
              Thanks Ben!
              That was a very quick reply! I will try this
              Best,
              Miltron

              Comment

              • corthay
                Member
                • Oct 2008
                • 25

                #352
                Question abou "-n" option.

                Hi,

                I would like to ask about "-n" option. I would like to map read
                following conditions.
                1. first N bases must be perfect match.
                2. reported position must be 'best' hit.

                I used " -n 0 -l N -a --best --strata ". I am wondering if the '--best'
                option is only guaranteed "-n" and '-l' option. For example, I worry
                that bowtie reports 1 mismatch hit even if there is perfect hit.

                Also, I would like to know the option to get random position
                if reads hit to multiple position.

                Thanks,
                Corthay.

                Comment

                • Ben Langmead
                  Senior Member
                  • Sep 2008
                  • 200

                  #353
                  Hi Corthay,

                  Originally posted by corthay View Post
                  I would like to ask about "-n" option. I would like to map read
                  following conditions.
                  1. first N bases must be perfect match.
                  2. reported position must be 'best' hit.

                  I used " -n 0 -l N -a --best --strata ". I am wondering if the '--best'
                  option is only guaranteed "-n" and '-l' option. For example, I worry
                  that bowtie reports 1 mismatch hit even if there is perfect hit.
                  --best = best in terms of stratum first and quality second. It should report all 0-penalty alignments before any non-0 penalty alignments. So it should do what you want.

                  Originally posted by corthay View Post
                  Also, I would like to know the option to get random position if reads hit to multiple position.
                  That's the default - you'll get that behavior if you omit the -a option.

                  Thanks,
                  Ben

                  Comment

                  • corthay
                    Member
                    • Oct 2008
                    • 25

                    #354
                    Hi Ben,

                    I appreciate your quick response.
                    I think I understood it.

                    Thanks,
                    Corthay

                    Comment

                    • didymos
                      Junior Member
                      • Jun 2010
                      • 8

                      #355
                      problem with SOLiD data mapping

                      Hi,
                      I am trying to map short reads from SOLiD into indexes generated from stem-loop sequences of miRs to get information about miRNA in my samples.
                      Indexes I have generated from fasta file (from miRBASE) by bowtie-build -C and it works great. However I have some problem with mapping... I will explain it with example:
                      mmu mir-378 -> ACTGGACTTGGAGTCAGAAGG
                      when I have converted it into colorspece (with T at the begining - from promotor) I got:
                      T312102120102212122020
                      Mapping this miRNA works great:
                      bowtie -a -n 0 -C ../mouse/miRNA-stem-loop -c T312102120102212122020

                      0 + mmT-mir-378 43 CTGGACTTGGAGTCAGAAG qqqqqqqqqqqqqqqqqqq 0


                      However in my reads from SOLiD I have reads of length 35 so this miRNA is longer and is:
                      T31210212010221212202033002010303111
                      but first 23 "numbers" are the same so using this option:
                      bowtie -a -n 0 -l 16 -C ../mouse/miRNA-stem-loop -c T31210212010221212202033002010303111
                      I should be able to map this read, but it does not work like this:
                      # reads processed: 1
                      # reads with at least one reported alignment: 0 (0.00%)
                      # reads that failed to align: 1 (100.00%)
                      No alignments

                      and I have no idea why...
                      Thank you for any sugestions!
                      Best

                      tomek

                      Comment

                      • afadda
                        Member
                        • Jun 2010
                        • 15

                        #356
                        hi. i get segmentation fault only when I run bwotie view on a certain data. it always stops at the same genome coordinates, whether it's in one big file with all chromosomes in, or just a file of that particular chromosome. can't tell what the problem is. help!!

                        Comment

                        • Ben Langmead
                          Senior Member
                          • Sep 2008
                          • 200

                          #357
                          bowtie view? I'm confused - can you send the exact command you're using?

                          Thanks,
                          Ben

                          Originally posted by afadda View Post
                          hi. i get segmentation fault only when I run bwotie view on a certain data. it always stops at the same genome coordinates, whether it's in one big file with all chromosomes in, or just a file of that particular chromosome. can't tell what the problem is. help!!

                          Comment

                          • Ben Langmead
                            Senior Member
                            • Sep 2008
                            • 200

                            #358
                            Originally posted by didymos View Post
                            However in my reads from SOLiD I have reads of length 35 so this miRNA is longer and is:
                            T31210212010221212202033002010303111
                            but first 23 "numbers" are the same so using this option:
                            bowtie -a -n 0 -l 16 -C ../mouse/miRNA-stem-loop -c T31210212010221212202033002010303111
                            I should be able to map this read, but it does not work like this:
                            # reads processed: 1
                            # reads with at least one reported alignment: 0 (0.00%)
                            # reads that failed to align: 1 (100.00%)
                            No alignments

                            and I have no idea why...
                            Thank you for any sugestions!
                            I think the problem is that you're assuming -n 0 -l 16 is going to allow any alignment with no mismatches in the first 16 colors, but the -e limit also applies. -e also needs to be set high enough so that the sum of the quality values of all the mismatched positions in your example are still <= the -e limit. If no quality values are supplied, qualities all = 30.

                            Hope that helps. You may also want to consider using trimming (e.g. -3).

                            Thanks,
                            Ben

                            Comment

                            • afadda
                              Member
                              • Jun 2010
                              • 15

                              #359
                              Originally posted by Ben Langmead View Post
                              bowtie view? I'm confused - can you send the exact command you're using?

                              Thanks,
                              Ben
                              sorry!! I actually meant samtools view. perhaps this is not the right string for my problem.
                              thanks

                              Comment

                              • issaac
                                Junior Member
                                • Jan 2010
                                • 1

                                #360
                                calling variants with samtools after bowtie -- very long lines in output

                                Hi,

                                I am facing the following situation. It looks like there could be an error in my approach, but I am trying to figure out. I would much appreciate your inputs/suggestions to resolve my problem.

                                1. (PROBLEM) I am trying to align PhiX-174 reads, obtained from GA IIx, on to the reference (from NCBI) using the bowtie program and then subsequently look for variants using samtools.

                                I am getting very long lines in the final SNP calling output file and the result doesn't look meaningful.

                                2. Illumina-analysis-software-generated fastq file, which I am using contains some 18 million read sequences.

                                3. If needed, I can provide a truncated version of the output, as the output is 366M in size.

                                4. To check the Bowtie installation on my computer, I ran the example provided in the Bowtie: Tutorial section, especially, Finding variations with samtools -- the run was successful.

                                I performed the following steps:

                                STEP #1: Generate Indexes for the PhiX-174 genome
                                bowtie-build phix174.fasta phix174

                                STEP #2: Perform alignment with bowtie and generate sam file
                                bowtie -S phix174 phix174.fastq phix174.sam

                                STEP #3: Convert sam to bam file
                                samtools view -bS -o phix174.bam phix174.sam

                                STEP #4: Sort the bam file in preparation for SNP calling
                                samtools sort phix174.bam phix174.sorted

                                STEP #5: Identify SNPs...
                                samtools pileup -cv -f phix174.fasta phix174.sorted.bam > phix174.variants

                                Thanks,
                                Issaac

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  Yesterday, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 02:55 AM
                                0 responses
                                12 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                12 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                13 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...