[skblazer]

Hi, Ben Langmead
Recently I used bowtie to align some solexa reads in 100bp length. But the matched ratio is low. I want to know what's your recommendation for the option parameters for the long reads such as 100bp?

Thank you

[cp229]

Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx

[Xi Wang]

Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx

The 454 reads may contain indel errors while sequencing. Also, longer reads may cover more indel variants in the reference genome. I think the indels could be the main reason why bowtie reported a low mappable ratio.

[Subho]

Is it possible to get mapping quality and read quality (a single value per read, e.g. calculated out of base quality) for Bowtie?

[didymos]

I think the problem is that you're assuming -n 0 -l 16 is going to allow any alignment with no mismatches in the first 16 colors, but the -e limit also applies. -e also needs to be set high enough so that the sum of the quality values of all the mismatched positions in your example are still <= the -e limit. If no quality values are supplied, qualities all = 30.

Hope that helps. You may also want to consider using trimming (e.g. -3).

Thanks,
Ben

Thank you Ben! and sorry for late response...
Now it works as I want
Best!

tomek

[cp229]

I think I`ve got that now!!Thank you very much Xi Wang.

[yeb3czg]

Hi all

I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
>bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

but I got the message
"Reads file contained a pattern with more than 1024 sequence characters.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted"

but if I'm using one file of the paired end reads as single end for alignment it works

There is no uncalled bases in my reads
Any idea about this issue ?

Thank you

AC

[Xi Wang]

Hi all

I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
>bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

but I got the message
"Reads file contained a pattern with more than 1024 sequence characters.
Please truncate reads and quality values and and re-run Bowtie
terminate called after throwing an instance of 'int'
Aborted"

but if I'm using one file of the paired end reads as single end for alignment it works

There is no uncalled bases in my reads
Any idea about this issue ?

Thank you

AC

Have you try to put the option -m ahead, like this?

bowtie  -m 1 -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt > xx.sam

[yeb3czg]

Xi
I tried it didn't change anything but I found what was the problem in one of my reads file the format of one lane was not correct
now it 's working
thanks

[didymos]

bowtie and solid

Hi,
I have another question about solid data...:
I have two different reads:
T32221113212031121021022123023302010
and
T22221113212031121021022123023302010
In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

Why?
Thanks for any suggestions!
Best!

tomek

[nilshomer]

Hi,
I have another question about solid data...:
I have two different reads:
T32221113212031121021022123023302010
and
T22221113212031121021022123023302010
In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

Why?
Thanks for any suggestions!
Best!

tomek

For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.

[didymos]

For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.

Thank you!
very clear presentation. However in my case things are little bit different.
I am mapping not to the whole genome but only to the miRNA sequences (previously indexed with bowtie-build). If I understand correctly color is identified as color error when after correction sequence can be easily mapped, but in my case this "error" sequence can be just not a miRNA sequence - other RNA type from RNA-seq experiment.
Question is how many color errors are allowed to be correct in bowtie - how I can set it or how can I switch it off if possible?
Thanks!

tomek

[laghs]

Missed alignment?

I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
# reads processed: 1
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments


../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)

[Xi Wang]

I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
# reads processed: 1
# reads with at least one reported alignment: 0 (0.00%)
# reads that failed to align: 1 (100.00%)
No alignments


../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
# reads processed: 1
# reads with at least one reported alignment: 1 (100.00%)
# reads that failed to align: 0 (0.00%)
Reported 1 alignments to 1 output stream(s)

I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.

[laghs]

I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.

I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.