Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • skblazer
    Member
    • Feb 2009
    • 51

    #361
    Hi, Ben Langmead
    Recently I used bowtie to align some solexa reads in 100bp length. But the matched ratio is low. I want to know what's your recommendation for the option parameters for the long reads such as 100bp?

    Thank you

    Comment

    • cp229
      Junior Member
      • Jun 2010
      • 5

      #362
      Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx

      Comment

      • Xi Wang
        Senior Member
        • Oct 2009
        • 317

        #363
        Originally posted by cp229 View Post
        Hi Ben, I am a very new beginner with bowtie. I have a question about it, hope you can help me out. When I run bowtie with 454 long reads(the read length is about 200bp), the result is very weird that nearly 98% of reads are mismatching. (I tried human, yeast and e_coli). Could you tell me that whether I can use bowtie to align the long read or not....Thx
        The 454 reads may contain indel errors while sequencing. Also, longer reads may cover more indel variants in the reference genome. I think the indels could be the main reason why bowtie reported a low mappable ratio.
        Xi Wang

        Comment

        • Subho
          Junior Member
          • Apr 2010
          • 2

          #364
          Is it possible to get mapping quality and read quality (a single value per read, e.g. calculated out of base quality) for Bowtie?

          Comment

          • didymos
            Junior Member
            • Jun 2010
            • 8

            #365
            Originally posted by Ben Langmead View Post
            I think the problem is that you're assuming -n 0 -l 16 is going to allow any alignment with no mismatches in the first 16 colors, but the -e limit also applies. -e also needs to be set high enough so that the sum of the quality values of all the mismatched positions in your example are still <= the -e limit. If no quality values are supplied, qualities all = 30.

            Hope that helps. You may also want to consider using trimming (e.g. -3).

            Thanks,
            Ben
            Thank you Ben! and sorry for late response...
            Now it works as I want
            Best!

            tomek

            Comment

            • cp229
              Junior Member
              • Jun 2010
              • 5

              #366
              I think I`ve got that now!!Thank you very much Xi Wang.

              Comment

              • yeb3czg
                Junior Member
                • Feb 2010
                • 2

                #367
                Hi all

                I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
                >bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

                but I got the message
                "Reads file contained a pattern with more than 1024 sequence characters.
                Please truncate reads and quality values and and re-run Bowtie
                terminate called after throwing an instance of 'int'
                Aborted"

                but if I'm using one file of the paired end reads as single end for alignment it works

                There is no uncalled bases in my reads
                Any idea about this issue ?

                Thank you

                AC

                Comment

                • Xi Wang
                  Senior Member
                  • Oct 2009
                  • 317

                  #368
                  Originally posted by yeb3czg View Post
                  Hi all

                  I got almost the same problem with bowtie. I tried to align paired end read in fastaQ format of 84 bp
                  >bowtie -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt -m 1 > xx.sam

                  but I got the message
                  "Reads file contained a pattern with more than 1024 sequence characters.
                  Please truncate reads and quality values and and re-run Bowtie
                  terminate called after throwing an instance of 'int'
                  Aborted"

                  but if I'm using one file of the paired end reads as single end for alignment it works

                  There is no uncalled bases in my reads
                  Any idea about this issue ?

                  Thank you

                  AC
                  Have you try to put the option -m ahead, like this?

                  Code:
                  bowtie  -m 1 -q -t --solexa1.3-quals -p 2 --sam xx_index.txt -1 xx.txt -2 xx.txt > xx.sam
                  Xi Wang

                  Comment

                  • yeb3czg
                    Junior Member
                    • Feb 2010
                    • 2

                    #369
                    Xi
                    I tried it didn't change anything but I found what was the problem in one of my reads file the format of one lane was not correct
                    now it 's working
                    thanks

                    Comment

                    • didymos
                      Junior Member
                      • Jun 2010
                      • 8

                      #370
                      bowtie and solid

                      Hi,
                      I have another question about solid data...:
                      I have two different reads:
                      T32221113212031121021022123023302010
                      and
                      T22221113212031121021022123023302010
                      In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

                      bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
                      0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


                      bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
                      0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

                      Why?
                      Thanks for any suggestions!
                      Best!

                      tomek

                      Comment

                      • nilshomer
                        Nils Homer
                        • Nov 2008
                        • 1283

                        #371
                        Originally posted by didymos View Post
                        Hi,
                        I have another question about solid data...:
                        I have two different reads:
                        T32221113212031121021022123023302010
                        and
                        T22221113212031121021022123023302010
                        In color space difference is only in one number - so in the base space those sequences are completely different, however with bowtie they are mapped to the same seq:

                        bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T32221113212031121021022123023302010
                        0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0


                        bowtie -a -n 0 -C ../indeks/miRNA-mature_cs -3 8 -c T22221113212031121021022123023302010
                        0 + mmT-miR-1944 1 TCTGTGCTGAATGTCAAGTTCTGAT qqqqqqqqqqqqqqqqqqqqqqqqq 0

                        Why?
                        Thanks for any suggestions!
                        Best!

                        tomek
                        For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.
                        Attached Files

                        Comment

                        • didymos
                          Junior Member
                          • Jun 2010
                          • 8

                          #372
                          Originally posted by nilshomer View Post
                          For one of the two sequences, the first color was probably identified as a color error (sequencing error) and corrected appropriately. Color errors (sequencing error) and base differences (SNPs) manifest differently. See the attached PDF for a brief explanation between the differences.
                          Thank you!
                          very clear presentation. However in my case things are little bit different.
                          I am mapping not to the whole genome but only to the miRNA sequences (previously indexed with bowtie-build). If I understand correctly color is identified as color error when after correction sequence can be easily mapped, but in my case this "error" sequence can be just not a miRNA sequence - other RNA type from RNA-seq experiment.
                          Question is how many color errors are allowed to be correct in bowtie - how I can set it or how can I switch it off if possible?
                          Thanks!

                          tomek

                          Comment

                          • laghs
                            Junior Member
                            • Jul 2010
                            • 2

                            #373
                            Missed alignment?

                            I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

                            ../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
                            # reads processed: 1
                            # reads with at least one reported alignment: 0 (0.00%)
                            # reads that failed to align: 1 (100.00%)
                            No alignments


                            ../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
                            0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
                            # reads processed: 1
                            # reads with at least one reported alignment: 1 (100.00%)
                            # reads that failed to align: 0 (0.00%)
                            Reported 1 alignments to 1 output stream(s)

                            Comment

                            • Xi Wang
                              Senior Member
                              • Oct 2009
                              • 317

                              #374
                              Originally posted by laghs View Post
                              I noticed that sometimes when I use Bowtie, if the only mismatch is at the 5' end, then no alignment will be produced. Could this be a bug from index building? Here is an example below. With only a single mismatch at the very 5' end, I expect to see the read aligned with -v 2. However, that is not the case. Could someone tell me why and how this can be corrected? Many thanks in advance.

                              ../bowtie-0.12.5/bowtie -t refseq_hs -c CGACTCTTAGCGGTGGATCACTCGG -v 2
                              # reads processed: 1
                              # reads with at least one reported alignment: 0 (0.00%)
                              # reads that failed to align: 1 (100.00%)
                              No alignments


                              ../bowtie-0.12.5/bowtie -t refseq_hs -c GACTCTTAGCGGTGGATCACTCGG -v 2
                              0 + gi|142372596|ref|NR_003285.2| 0 GACTCTTAGCGGTGGATCACTCGG IIIIIIIIIIIIIIIIIIIIIIII 0
                              # reads processed: 1
                              # reads with at least one reported alignment: 1 (100.00%)
                              # reads that failed to align: 0 (0.00%)
                              Reported 1 alignments to 1 output stream(s)
                              I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.
                              Xi Wang

                              Comment

                              • laghs
                                Junior Member
                                • Jul 2010
                                • 2

                                #375
                                Originally posted by Xi Wang View Post
                                I think your case was due to Bowtie cann't deal with indel, but not because of 5' mismatches. Note that the aligned position for read GACTCTTAGCGGTGGATCACTCGG (your 2nd read) is 0 (0-based), so for your 1st read: CGACTCTTAGCGGTGGATCACTCGG, it was not able to map to the reference sequences.
                                I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 10:13 AM
                                0 responses
                                14 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                28 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                21 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                20 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...