[biznatch]

Hi,
I am also getting:
C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.
Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT

I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
Thanks a lot,

David

--edit--:
I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
--edit2--:
I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XP

I'm having the exact same problem, trying to align chip-seq data to hg19, under XP, with 3GB RAM.

[nashp]

n's in data

Hi Ben,
I have a couple of questions regarding how bowtie handles the data. I have a reference genome and a set of reads. My ref sequence has n's and a lot of reads also have n's in between.

How does bowtie handle these n's
1) while building ref genome index?
2) for reads?

Elsewhere in the same thread, I found you sayin that "When Bowtie indexes the reference, it elides non-A/C/G/T characters. So if you index a reference with stretches of Ns, Bowtie will never report an alignment spanning any of the stretches."

Does this mean you chuck n's while building the index? if yes, don't these n's have positional information? are these n's of any importance?

Thanks
Nash

[alvin]

Reverse complement

I am working on RNA-Seq data and I aligned the reads to a reference genome with bowtie.
I got the output files in SAM format and now I wonder how can I know for each read if it aligns directly or whether it is the reverse complement that aligns to the reference genome in the SAM format file.
I would really appreciate any help.
Best Regards



alvin

[jyoshna.jo]

Hi All,

I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

Thanks a lot.
jo

[Xi Wang]

Hi All,

I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

Thanks a lot.
jo

Generally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.

[jyoshna.jo]

Can you please tell me what is the cost for sequencing human genome by Applied Biosystem SOLiD? Which is the best sequencer for genome analysis?

[david2]

Hi jyoshna,
What kind of application do you have in mind? All machines and software packages have advantages and disadvantages depending on what you want to do (re-sequencing? De novo? SNP detection? Indels?Whole genome or targeted?)

[gntc]

hg19 and allocation issues

I am new to bowtie and I am having a couple problems. First, I downloaded the hg19 ebwt files and attempted to transfer them to the server where I will be running bowtie but received errors for 5 of the 6 files. Despite the errors the file names still appeared on the server and to check if they were functional I tried a trial run:

./bowtie -c -t hg19 CTGAGCTTGACGCTTTGCTAATATNGTAAGAAGAGAAACTATTAATTATGGCTTTCTAAAATTGAATATCCTTGTACACA

this was the response:

Out of memory allocating plen[] in Ebwt::read() at ebwt.h:3153
Overall time: 00:00:00

What can I do?

Thanks, Greg

[tonge]

Generally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.

Hi XiWang,
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete

[biznatch]

Hi XiWang,
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete

I think it's because Bowtie doesn't recognize splice junctions. Ie. when you sequence your RNA is often aligns across introns so there is a large gap in the alignment. Tophat uses the Bowtie alignment algorithm but can align across splice junctions. ...or something like that.

[nilshomer]

Hi XiWang,
Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
Thanks, Pete

It is not able to handle spliced reads, as biznatch mentioned.

I think it's because Bowtie doesn't recognize splice junctions. Ie. when you sequence your RNA is often aligns across introns so there is a large gap in the alignment. Tophat uses the Bowtie alignment algorithm but can align across splice junctions. ...or something like that.

Just to be clear, Tophat doesn't align anything by itself. Tophat creates a junction reference, where possible splice junctions are represented as contiguous sequences in the FASTA reference, allowing bowtie to map properly to these putative junctions. Take a look at the Tophat paper for more information.

[Xi Wang]

Nowadays, spliced read mappers first split reads into segments, then apply mappers such as Bowtie to map those segments onto the reference genome. The segments belong to a read can be mapped with a long distance between, so that the splice junctions can be detected.
What Nishomer mentioned is an old version of Tophat, when the read length is short.

[nashp]

question about bowtie's handling of long reads

Hey guys,
I have a question about bowtie's performance when we increase the length of the reads. Initially i used to run bowtie for reads length = 35. Now I am running the exps with reads length 51.

When I read bowtie's manual, I noticed they say bowtie's performance decreases as the read length increases. On the contrary, i am seeing its performance become better when I shifted from 35 to 51. Could you guys please tell me why? is it normal for bowtie to behave this way??

how short is short reads and how long is long reads (in terms of base pairs) ?

[gntc]

Repeats

Does the hg19 index mask repeats in the genome?

I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?

[biznatch]

Does the hg19 index mask repeats in the genome?

I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?

Depends whether the index was made from the masked version of hg19 or not. I'm pretty sure the pre-made index from the Bowtie website is made from the non-masked genome. Both masked and non-masked are available here:

http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/

"chromFa.tar.gz - The assembly sequence in one file per chromosome.
Repeats from RepeatMasker and Tandem Repeats Finder (with period
of 12 or less) are shown in lower case; non-repeating sequence is
shown in upper case.

chromFaMasked.tar.gz - The assembly sequence in one file per chromosome.
Repeats are masked by capital Ns; non-repeating sequence is shown in
upper case."