Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • biznatch
    Senior Member
    • Nov 2010
    • 124

    #406
    Originally posted by david2 View Post
    Hi,
    I am also getting:
    C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
    Out of memory allocating the ebwt[] array for the Bowtie index. Please try
    again on a computer with more memory.
    Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT

    I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
    Thanks a lot,

    David

    --edit--:
    I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
    --edit2--:
    I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XP
    I'm having the exact same problem, trying to align chip-seq data to hg19, under XP, with 3GB RAM.

    Comment

    • nashp
      Junior Member
      • Jan 2011
      • 4

      #407
      n's in data

      Hi Ben,
      I have a couple of questions regarding how bowtie handles the data. I have a reference genome and a set of reads. My ref sequence has n's and a lot of reads also have n's in between.

      How does bowtie handle these n's
      1) while building ref genome index?
      2) for reads?

      Elsewhere in the same thread, I found you sayin that "When Bowtie indexes the reference, it elides non-A/C/G/T characters. So if you index a reference with stretches of Ns, Bowtie will never report an alignment spanning any of the stretches."

      Does this mean you chuck n's while building the index? if yes, don't these n's have positional information? are these n's of any importance?

      Thanks
      Nash
      Last edited by nashp; 01-11-2011, 05:07 PM. Reason: found an update

      Comment

      • alvin
        Junior Member
        • Oct 2010
        • 9

        #408
        Reverse complement

        I am working on RNA-Seq data and I aligned the reads to a reference genome with bowtie.
        I got the output files in SAM format and now I wonder how can I know for each read if it aligns directly or whether it is the reverse complement that aligns to the reference genome in the SAM format file.
        I would really appreciate any help.
        Best Regards



        alvin

        Comment

        • jyoshna.jo
          Junior Member
          • Jan 2011
          • 3

          #409
          Hi All,

          I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

          with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

          Thanks a lot.
          jo

          Comment

          • Xi Wang
            Senior Member
            • Oct 2009
            • 317

            #410
            Originally posted by jyoshna.jo View Post
            Hi All,

            I am a new user of NGS softwares. Thanks a lot for providing such a list. Are there any updates????????????

            with so many tools (e.g. in the ALign/assemble field), do anyone has any idea on which tool are the best for use (in terms of ease of usage and computation time required)?????

            Thanks a lot.
            jo
            Generally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.
            Xi Wang

            Comment

            • jyoshna.jo
              Junior Member
              • Jan 2011
              • 3

              #411
              Can you please tell me what is the cost for sequencing human genome by Applied Biosystem SOLiD? Which is the best sequencer for genome analysis?

              Comment

              • david2
                Member
                • May 2010
                • 19

                #412
                Hi jyoshna,
                What kind of application do you have in mind? All machines and software packages have advantages and disadvantages depending on what you want to do (re-sequencing? De novo? SNP detection? Indels?Whole genome or targeted?)

                Comment

                • gntc
                  Member
                  • Feb 2011
                  • 17

                  #413
                  hg19 and allocation issues

                  I am new to bowtie and I am having a couple problems. First, I downloaded the hg19 ebwt files and attempted to transfer them to the server where I will be running bowtie but received errors for 5 of the 6 files. Despite the errors the file names still appeared on the server and to check if they were functional I tried a trial run:

                  ./bowtie -c -t hg19 CTGAGCTTGACGCTTTGCTAATATNGTAAGAAGAGAAACTATTAATTATGGCTTTCTAAAATTGAATATCCTTGTACACA

                  this was the response:

                  Out of memory allocating plen[] in Ebwt::read() at ebwt.h:3153
                  Overall time: 00:00:00

                  What can I do?

                  Thanks, Greg

                  Comment

                  • tonge
                    Junior Member
                    • Mar 2011
                    • 5

                    #414
                    Originally posted by Xi Wang View Post
                    Generally, there is not a tool simply better than the others. It depends on what your scientific questions are, what kind of data you have, what the purpose is to analyze the data. For example, Bowtie is not suitable to deal with RNA-seq data.
                    Hi XiWang,
                    Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
                    Thanks, Pete

                    Comment

                    • biznatch
                      Senior Member
                      • Nov 2010
                      • 124

                      #415
                      Originally posted by tonge View Post
                      Hi XiWang,
                      Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
                      Thanks, Pete
                      I think it's because Bowtie doesn't recognize splice junctions. Ie. when you sequence your RNA is often aligns across introns so there is a large gap in the alignment. Tophat uses the Bowtie alignment algorithm but can align across splice junctions. ...or something like that.

                      Comment

                      • nilshomer
                        Nils Homer
                        • Nov 2008
                        • 1283

                        #416
                        Originally posted by tonge View Post
                        Hi XiWang,
                        Could you please tell me why is bowtie not suitable for RNA seq? Especially since Bowtie is utilised by tophat software.
                        Thanks, Pete
                        It is not able to handle spliced reads, as biznatch mentioned.

                        Originally posted by biznatch View Post
                        I think it's because Bowtie doesn't recognize splice junctions. Ie. when you sequence your RNA is often aligns across introns so there is a large gap in the alignment. Tophat uses the Bowtie alignment algorithm but can align across splice junctions. ...or something like that.
                        Just to be clear, Tophat doesn't align anything by itself. Tophat creates a junction reference, where possible splice junctions are represented as contiguous sequences in the FASTA reference, allowing bowtie to map properly to these putative junctions. Take a look at the Tophat paper for more information.

                        Comment

                        • Xi Wang
                          Senior Member
                          • Oct 2009
                          • 317

                          #417
                          Nowadays, spliced read mappers first split reads into segments, then apply mappers such as Bowtie to map those segments onto the reference genome. The segments belong to a read can be mapped with a long distance between, so that the splice junctions can be detected.
                          What Nishomer mentioned is an old version of Tophat, when the read length is short.
                          Xi Wang

                          Comment

                          • nashp
                            Junior Member
                            • Jan 2011
                            • 4

                            #418
                            question about bowtie's handling of long reads

                            Hey guys,
                            I have a question about bowtie's performance when we increase the length of the reads. Initially i used to run bowtie for reads length = 35. Now I am running the exps with reads length 51.

                            When I read bowtie's manual, I noticed they say bowtie's performance decreases as the read length increases. On the contrary, i am seeing its performance become better when I shifted from 35 to 51. Could you guys please tell me why? is it normal for bowtie to behave this way??

                            how short is short reads and how long is long reads (in terms of base pairs) ?

                            Comment

                            • gntc
                              Member
                              • Feb 2011
                              • 17

                              #419
                              Repeats

                              Does the hg19 index mask repeats in the genome?

                              I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?

                              Comment

                              • biznatch
                                Senior Member
                                • Nov 2010
                                • 124

                                #420
                                Originally posted by gntc View Post
                                Does the hg19 index mask repeats in the genome?

                                I have illumina data that has a large number of repeats. The sequences have been mapped using ELAND and found that ~30% had >10 matches. When using bowtie about 10% have >10 matches. What accounts for this difference? Does the hg19 index mask repeats?

                                Depends whether the index was made from the masked version of hg19 or not. I'm pretty sure the pre-made index from the Bowtie website is made from the non-masked genome. Both masked and non-masked are available here:



                                "chromFa.tar.gz - The assembly sequence in one file per chromosome.
                                Repeats from RepeatMasker and Tandem Repeats Finder (with period
                                of 12 or less) are shown in lower case; non-repeating sequence is
                                shown in upper case.

                                chromFaMasked.tar.gz - The assembly sequence in one file per chromosome.
                                Repeats are masked by capital Ns; non-repeating sequence is shown in
                                upper case."

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  New Genomics Technologies Take Aim at Long-Standing Limits
                                  by SEQadmin2


                                  Researchers using sequencing and genomics tools often have to make trade-offs. They can choose between speed or scale, short reads or long-range information, or targeted panels or a view of the whole transcriptome. New technologies that have been released this year are built to address those tough choices.

                                  We asked six companies the same four questions to learn about their latest products. The new technologies bring a lot to the table, including rethinking sequencing
                                  ...
                                  Yesterday, 10:25 AM
                                • SEQadmin2
                                  How Immunogenomics Decodes Immunity’s Genetic Blueprint
                                  by SEQadmin2




                                  The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.

                                  This convergence of genetics, immunology, and computation...
                                  09-01-2026, 05:41 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 09-25-2026, 09:06 AM
                                0 responses
                                29 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-23-2026, 11:05 AM
                                0 responses
                                24 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 09-18-2026, 11:37 AM
                                1 response
                                46 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Started by SEQadmin2, 09-16-2026, 10:23 AM
                                1 response
                                55 views
                                0 reactions
                                Last Post pekgio
                                by pekgio
                                 
                                Working...