[oxydeepu]

Hi all,

I am running bowtie, i have this query that can we specify the mismatches to be at a particular end, say 3'...??
waiting for a reply
Thanking you
Deepak

[oxydeepu]

Hi all,

I am running bowtie, i have this query that is there any way can we specify the mismatches to be at a particular end, say 3'...??
waiting for a reply
Thanking you

Deepak

[rahilsethi]

Extra parameter(s) specified error

I am running bowtie version 0.12.7 for mapping SOLiD (colorspace 50bp read length) data against human genome (hg19), on a linux platform (CentOS). When I run with the following parameters:

$bowtie -C -f -Q sample_QV.qual -a --best --strata -n -l 20 --maxbts --chunkmbs 1000 -t --al 50_mapped_reads.csfasta --sam -p 5 /bowtie-ref-build/hg19/hg19 sample.csfasta 50_mapping.sam

it gives me the following error

Extra parameter(s) specified: "sample.csfasta", "50_mapping.sam"

and when I was running with default seed-length(-l) value by not defining
-l 20 i.e.:

$bowtie -C -f -Q sample_QV.qual -a --best --strata -n --maxbts --chunkmbs 1000 -t --al 50_mapped_reads.csfasta --sam -p 5 /bowtie-ref-build/hg19/hg19 sample.csfasta 50_mapping.sam

it runs successfully, generating the number of reads mapped and unmapped
details on the screen.

How can I then run the program at different seed length when I run bowtie
since, as seen above, it does not run whenever I mention seed length
within permissible range (i.e. 20 > 5 for read length 50bp)?

[westerman]

There error messages makes me think that you are missing some parameter options. In particular '-n' should have a number after it; e.g., '-n 2' as should '--maxbts'.

What I think is happening in the successful line where you have '-n --maxbts' is that the 'n' parameter is reading in '--maxbts' as the number to use. Thus there is no problem.

Where as in the bad line you have '-n -l 20 --maxbts --chunkmbs' with the results that '-n' is swallowing (using) '-l' ... '20' is being skipped, '--maxbts' is swallowing '--chunkmbs' which then throws off the rest of the command line.

Anyway that is my guess. Please try your command either with numbers after '-n' and '--maxbts' or just get rid of those two parameters.

[rahilsethi]

Re: Extra parameter(s) specified error

the reason why I did not give any value to -n and --maxbts because I am trying to use their default values. If I wouldn't mention -n then how would bowtie know whether I want to do mapping with -n or -v options? I will give it a try by giving numbers to all of them though, but I think it should not give any problem because I did not give value to -n and --maxbts

[mediator]

Hi All,
I am running bowtie on a pair end alignment (illumina hiseq). Here is the command and the output I got:

bowtie -p 4 -v 2 -k 11 -m 10 -t --best /bowtie/indexes/hg19 -1 /data/rna_seq/0916_1.fq -2 /data/rna_seq/0916_2.fq /data/rna_seq/0916.SAM -S

Time loading forward index: 00:00:08
Time loading mirror index: 00:00:08
Time loading reference: 00:00:03
End-to-end 2/3-mismatch full-index search: 04:48:55
# reads processed: 114497412
# reads with at least one reported alignment: 64037326 (55.93%)
# reads that failed to align: 50290127 (43.92%)
# reads with alignments suppressed due to -m: 169959 (0.15%)
Reported 94715801 paired-end alignments to 1 output stream(s)
Time searching: 04:49:14
Overall time: 04:49:14

Not sure why I have so many reads fail to align?

[biznatch]

mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.

[mediator]

mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.

Yes, my data was RNA-Seq. Thanks for the advice! Do you think -X will help?

[Nick]

Apparently, it is normal that some reads are skipped because they can't align. Just hope the percentage that is skipped isn't too high!

I know this thread is quite old, but just wanted to point out this is not normal.

http://sourceforge.net/tracker/index.php?func=detail&aid=3049179&group_id=236897&atid=1101606

The search tree is exceeding the default available memory.

[rfrancis]

Bowtie truncates ID line if it has spaces

Dear all,
Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

SRR064286.51418

However when no match is found the ID is reported in full.

This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

Many thanks in advance.

Reads: Save as test.fq
@SRR064286.10 HWI-EAS418:1:4:1:147 length=50
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
+SRR064286.10 HWI-EAS418:1:4:1:147 length=50
BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
@SRR064286.11 HWI-EAS418:1:4:1:119 length=50
GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
+SRR064286.11 HWI-EAS418:1:4:1:119 length=50
BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
>testref
ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

Thanks for your help
Rich

[Xi Wang]

There is an option in Bowtie v0.12.7: --fullref, which can make the output file contain the entire names.

Dear all,
Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

SRR064286.51418

However when no match is found the ID is reported in full.

This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

Many thanks in advance.

Reads: Save as test.fq
@SRR064286.10 HWI-EAS418:1:4:1:147 length=50
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
+SRR064286.10 HWI-EAS418:1:4:1:147 length=50
BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
@SRR064286.11 HWI-EAS418:1:4:1:119 length=50
GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
+SRR064286.11 HWI-EAS418:1:4:1:119 length=50
BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
>testref
ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

Thanks for your help
Rich

[rfrancis]

Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
Regards,
Rich

[Xi Wang]

Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
Regards,
Rich

Sorry Rich. I have run a test on you test data, and found that --fullref only applied to reference sequences. If there are no solutions bowtie can provide, you may (i) first edit your fq files to remove any spaces in IDs, or (ii) use other tools. I know exactly that GSNAP can keep spaces in IDs when mapping RAN-seq reads.

[rfrancis]

No worries Xi Wang. Thanks for your help.
I just submitted this as a bug on their sourceforge site (ID: 3496148). There's also a similar report there too so I know it's not just me having this problem! Hopefully they can fix this easily.
Regards,
Rich

[niteesh.prasad]

Bowtie-Output

Hey! I am running the bowtie aligner on about 1000 files and storing the results in .map files. I want to save the timing results in the output files as well. Any idea how to do this? Thanks a lot!