Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • oxydeepu
    Member
    • Jul 2011
    • 41

    Hi all,

    I am running bowtie, i have this query that can we specify the mismatches to be at a particular end, say 3'...??
    waiting for a reply
    Thanking you
    Deepak

    Comment

    • oxydeepu
      Member
      • Jul 2011
      • 41

      Hi all,

      I am running bowtie, i have this query that is there any way can we specify the mismatches to be at a particular end, say 3'...??
      waiting for a reply
      Thanking you

      Deepak
      Last edited by oxydeepu; 10-09-2011, 01:58 AM. Reason: did not get any reply

      Comment

      • rahilsethi
        Member
        • May 2010
        • 22

        Extra parameter(s) specified error

        I am running bowtie version 0.12.7 for mapping SOLiD (colorspace 50bp read length) data against human genome (hg19), on a linux platform (CentOS). When I run with the following parameters:

        $bowtie -C -f -Q sample_QV.qual -a --best --strata -n -l 20 --maxbts --chunkmbs 1000 -t --al 50_mapped_reads.csfasta --sam -p 5 /bowtie-ref-build/hg19/hg19 sample.csfasta 50_mapping.sam
        it gives me the following error

        Extra parameter(s) specified: "sample.csfasta", "50_mapping.sam"

        and when I was running with default seed-length(-l) value by not defining
        -l 20 i.e.:


        $bowtie -C -f -Q sample_QV.qual -a --best --strata -n --maxbts --chunkmbs 1000 -t --al 50_mapped_reads.csfasta --sam -p 5 /bowtie-ref-build/hg19/hg19 sample.csfasta 50_mapping.sam
        it runs successfully, generating the number of reads mapped and unmapped
        details on the screen.

        How can I then run the program at different seed length when I run bowtie
        since, as seen above, it does not run whenever I mention seed length
        within permissible range (i.e. 20 > 5 for read length 50bp)?

        Comment

        • westerman
          Rick Westerman
          • Jun 2008
          • 1104

          There error messages makes me think that you are missing some parameter options. In particular '-n' should have a number after it; e.g., '-n 2' as should '--maxbts'.

          What I think is happening in the successful line where you have '-n --maxbts' is that the 'n' parameter is reading in '--maxbts' as the number to use. Thus there is no problem.

          Where as in the bad line you have '-n -l 20 --maxbts --chunkmbs' with the results that '-n' is swallowing (using) '-l' ... '20' is being skipped, '--maxbts' is swallowing '--chunkmbs' which then throws off the rest of the command line.

          Anyway that is my guess. Please try your command either with numbers after '-n' and '--maxbts' or just get rid of those two parameters.

          Comment

          • rahilsethi
            Member
            • May 2010
            • 22

            Re: Extra parameter(s) specified error

            the reason why I did not give any value to -n and --maxbts because I am trying to use their default values. If I wouldn't mention -n then how would bowtie know whether I want to do mapping with -n or -v options? I will give it a try by giving numbers to all of them though, but I think it should not give any problem because I did not give value to -n and --maxbts

            Comment

            • mediator
              Member
              • Nov 2010
              • 27

              Hi All,
              I am running bowtie on a pair end alignment (illumina hiseq). Here is the command and the output I got:
              bowtie -p 4 -v 2 -k 11 -m 10 -t --best /bowtie/indexes/hg19 -1 /data/rna_seq/0916_1.fq -2 /data/rna_seq/0916_2.fq /data/rna_seq/0916.SAM -S

              Time loading forward index: 00:00:08
              Time loading mirror index: 00:00:08
              Time loading reference: 00:00:03
              End-to-end 2/3-mismatch full-index search: 04:48:55
              # reads processed: 114497412
              # reads with at least one reported alignment: 64037326 (55.93%)
              # reads that failed to align: 50290127 (43.92%)
              # reads with alignments suppressed due to -m: 169959 (0.15%)
              Reported 94715801 paired-end alignments to 1 output stream(s)
              Time searching: 04:49:14
              Overall time: 04:49:14
              Not sure why I have so many reads fail to align?

              Comment

              • biznatch
                Senior Member
                • Nov 2010
                • 124

                mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.

                Comment

                • mediator
                  Member
                  • Nov 2010
                  • 27

                  Originally posted by biznatch View Post
                  mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.
                  Yes, my data was RNA-Seq. Thanks for the advice! Do you think -X will help?

                  Comment

                  • Nick
                    Member
                    • Jun 2009
                    • 16

                    Originally posted by Lien View Post
                    Apparently, it is normal that some reads are skipped because they can't align. Just hope the percentage that is skipped isn't too high!
                    I know this thread is quite old, but just wanted to point out this is not normal.

                    The search tree is exceeding the default available memory.

                    Comment

                    • rfrancis
                      Junior Member
                      • Jul 2011
                      • 7

                      Bowtie truncates ID line if it has spaces

                      Dear all,
                      Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

                      SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

                      In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

                      SRR064286.51418

                      However when no match is found the ID is reported in full.

                      This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

                      Many thanks in advance.

                      Reads: Save as test.fq
                      @SRR064286.10 HWI-EAS418:1:4:1:147 length=50
                      TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
                      +SRR064286.10 HWI-EAS418:1:4:1:147 length=50
                      BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
                      @SRR064286.11 HWI-EAS418:1:4:1:119 length=50
                      GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
                      +SRR064286.11 HWI-EAS418:1:4:1:119 length=50
                      BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

                      Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
                      >testref
                      ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
                      TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
                      GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

                      Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

                      Thanks for your help
                      Rich
                      Last edited by rfrancis; 02-29-2012, 08:57 PM.

                      Comment

                      • Xi Wang
                        Senior Member
                        • Oct 2009
                        • 317

                        There is an option in Bowtie v0.12.7: --fullref, which can make the output file contain the entire names.

                        Originally posted by rfrancis View Post
                        Dear all,
                        Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

                        SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

                        In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

                        SRR064286.51418

                        However when no match is found the ID is reported in full.

                        This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

                        Many thanks in advance.

                        Reads: Save as test.fq
                        @SRR064286.10 HWI-EAS418:1:4:1:147 length=50
                        TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
                        +SRR064286.10 HWI-EAS418:1:4:1:147 length=50
                        BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
                        @SRR064286.11 HWI-EAS418:1:4:1:119 length=50
                        GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
                        +SRR064286.11 HWI-EAS418:1:4:1:119 length=50
                        BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

                        Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
                        >testref
                        ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
                        TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
                        GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

                        Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

                        Thanks for your help
                        Rich
                        Xi Wang

                        Comment

                        • rfrancis
                          Junior Member
                          • Jul 2011
                          • 7

                          Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
                          Regards,
                          Rich
                          Last edited by rfrancis; 02-29-2012, 10:19 PM.

                          Comment

                          • Xi Wang
                            Senior Member
                            • Oct 2009
                            • 317

                            Originally posted by rfrancis View Post
                            Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
                            Regards,
                            Rich
                            Sorry Rich. I have run a test on you test data, and found that --fullref only applied to reference sequences. If there are no solutions bowtie can provide, you may (i) first edit your fq files to remove any spaces in IDs, or (ii) use other tools. I know exactly that GSNAP can keep spaces in IDs when mapping RAN-seq reads.
                            Xi Wang

                            Comment

                            • rfrancis
                              Junior Member
                              • Jul 2011
                              • 7

                              No worries Xi Wang. Thanks for your help.
                              I just submitted this as a bug on their sourceforge site (ID: 3496148). There's also a similar report there too so I know it's not just me having this problem! Hopefully they can fix this easily.
                              Regards,
                              Rich

                              Comment

                              • niteesh.prasad
                                Junior Member
                                • Feb 2012
                                • 6

                                Bowtie-Output

                                Hey! I am running the bowtie aligner on about 1000 files and storing the results in .map files. I want to save the timing results in the output files as well. Any idea how to do this? Thanks a lot!

                                Comment

                                Latest Articles

                                Collapse

                                • mylaser
                                  Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by mylaser
                                  Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
                                  If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
                                  This guide explains everything you need to know about...
                                  Yesterday, 01:13 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 07-09-2026, 10:04 AM
                                0 responses
                                19 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                11 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-07-2026, 11:05 AM
                                0 responses
                                26 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...