Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • ymc
    Senior Member
    • Mar 2010
    • 496

    #466
    Is this the right way to use bowtie to align reads from an 1000 genome sample (e.g. NA18526) to the human genome?

    First, I downloaded three files from 1000genomes
    ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz
    ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz
    ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz

    I downloaded the hg19 index files from
    ftp://ftp.cbcb.umd.edu/pub/data/bowt...g19.ebwt.1.zip
    ftp://ftp.cbcb.umd.edu/pub/data/bowt...g19.ebwt.2.zip

    Unzipped them and put them in the indexes subdirectory.

    Then I run the following command on my dual hex-core machine with 48GB RAM:

    time ./bowtie -p 12 --chunkmbs 200 -S hg19 -1 NA18526/ERR031854_1.filt.fastq -2 NA18526/ERR031854_2.filt.fastq NA18526.sam

    It took about 65min to finish. Am I doing it right?

    What is the use of the small ERR031854.filt.fastq at 1000genomes.org??

    Thanks a lot in advance!

    Comment

    • gntc
      Member
      • Feb 2011
      • 17

      #467
      Duplicate outputs

      I have some reads that were reported to map to hg19 uniquely (only one place in the genome) but they have two lines of output. The two lines are completely identical. This happened for many reads. Has anyone else had this problem?

      Comment

      • amaer
        Member
        • Oct 2009
        • 15

        #468
        the M option in Bowtie2 beta1.3

        Hi,

        I have a question about the use of the M parameter in Bowtie2 beta1.3. I understand it's the number of valid, distinct alignments found for each read (M+1 actually). And reports only 1, the best alignment of THOSE examined.

        If a read maps to multiple places, in human genome for example, I expect that Bowtie2 to possibly have different best alignment reported for different M values.

        Is it possible to have a 36 bp read NOT mapped at all (to human genome) with M =1, but mapped in other places with a higher values for M? If yes, why?

        Thanks!

        Comment

        • Xi Wang
          Senior Member
          • Oct 2009
          • 317

          #469
          It seems that it has nothing to do with M if a read is not mappable. Because in this mode, "The search terminates when it can't find more distinct valid alignments, or when it finds M+1 distinct alignments, whichever happens first." As the read is unmappable, the searching will always ends up with the former condition, no matter whatever M is.
          Xi Wang

          Comment

          • amaer
            Member
            • Oct 2009
            • 15

            #470
            But the read IS mappable (1 mismatch only for 36 bp)! And I can see that when I increase M. I mean, with M 1, it did not map anywhere on the human genome, but it did so when I increased M (keeping all other parameters constant - N, L, i etc. And when I use -a (all) alignments option I get tens of alignments. I find that very strange.
            I expect that regardless of the M value, at least one of the alignments would be reported, not necessarily the best one.
            Last edited by amaer; 05-24-2012, 09:28 PM.

            Comment

            • Xi Wang
              Senior Member
              • Oct 2009
              • 317

              #471
              Seems its a bug of Bowtie2. Probably you may report it to the developers.
              Xi Wang

              Comment

              • LizBent
                Member
                • Jan 2012
                • 31

                #472
                Hi, Bowtie noob question here. I have some paired read data where there are unpaired reads (that is, these reads were removed in preprocessing because they were too short, so that there are sequences in read1.fastq that are not present in read2.fastq, and vice versa). Can I use this with Bowtie, or should I go back to the raw data and re-process it (to remove primers and adapters) this time without removing any sequences? The data was originally prepared for use with Trinity, which supports unpaired reads in paired end data.

                Comment

                • rsinha
                  Junior Member
                  • May 2012
                  • 5

                  #473
                  Bowtie2: How to reproduce example alignment

                  I am running Bowtie2 to reproduce the example mentioned in the Manual but all in vain. Here is the example I am trying to reproduce:
                  End-to-end alignment example

                  Read: GACTGGGCGATCTCGACTTCG
                  Reference: GACTGCGATCTCGACATCG

                  Alignment:
                  Read: GACTGGGCGATCTCGACTTCG
                  || || | || || || |||| || ||
                  Reference: GACTG--CGATCTCGACATCG

                  I will be glad if someone let me know what parameters were used to find above alignment. OR someone who is able to do it
                  Last edited by rsinha; 06-01-2012, 05:03 AM.

                  Comment

                  • Dario1984
                    Senior Member
                    • Jun 2011
                    • 166

                    #474
                    Any plans to implement --best and --strata for paired-end mode ? I get a lot less reads mapping with -v 3 -m 1 because it isn't present.

                    Comment

                    • Tobias Kockmann
                      Member
                      • Sep 2011
                      • 10

                      #475
                      -m parameter in "end-to-end" mode

                      Dear Bowtie developers/users,

                      I have seen the following line of code in a Nature protocol for aligning 36 bp quality-pre-filtered ChIP-seq reads to the Drosophila genome. I was asking myself, if they are really sensible:

                      bowtie -q -m 1 -v 3 --best --strata

                      As I under stood from the Bowtie publication, -v mode will create "end-to-end" hits, but totally ignores quality information. The alignment ranking is therefor purely based on the number of mismatches (stratum). Since the max. number of mismatches is set to 3, valid alignments will be allowed to contain up to 3 mismatched position over the complete 36mer. The reporting option -m 1 means that Bowtie will only report an alignment, if the read is unique.

                      Lets assumes the following scenarios for a single read:

                      a.)
                      alignment a, perfect match
                      alignment b, 1 mismatched position

                      Bowtie will report a, right?

                      b.)
                      alignment a, perfect match
                      alignment b, perfect match

                      Bowtie will report no match for the read, since both valid alignments have the same rank.

                      But, what do the options --best and --strata trigger in "end-to-end" mode??? Do they do anything?

                      Greetings,
                      Tobi

                      Comment

                      • M4love
                        Junior Member
                        • May 2013
                        • 6

                        #476
                        Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.

                        Comment

                        • LizBent
                          Member
                          • Jan 2012
                          • 31

                          #477
                          Originally posted by M4love View Post
                          Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.
                          Did you follow the installation instructions? If you did, and were successful, you can type

                          bowtie

                          into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.

                          Comment

                          • M4love
                            Junior Member
                            • May 2013
                            • 6

                            #478
                            Originally posted by LizBent View Post
                            Did you follow the installation instructions? If you did, and were successful, you can type

                            bowtie

                            into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.
                            Hey where should i type Bowtie
                            in the R software or in the terminal?

                            Comment

                            • M4love
                              Junior Member
                              • May 2013
                              • 6

                              #479
                              Thanks a lot though. I really feel stupid

                              Comment

                              • M4love
                                Junior Member
                                • May 2013
                                • 6

                                #480
                                Originally posted by M4love View Post
                                Hey where should i type Bowtie
                                in the R software or in the terminal?
                                and I followed these instructions

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 07:41 AM
                                0 responses
                                11 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-31-2026, 02:55 AM
                                0 responses
                                38 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                25 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...