Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #481
    Originally posted by M4love View Post
    Hey where should i type Bowtie
    in the R software or in the terminal?
    In the terminal, bowtie has nothing to do with R.

    Comment

    • kumarS_27
      Junior Member
      • Dec 2011
      • 7

      #482
      error with Bowtie

      [QUOTE=Ben Langmead;2022]Hello all,

      If you work with large genomes and large sets of short reads, please
      take a look at Bowtie (http://bowtie-bio.sf.net), a new open source
      short read aligner written by myself and Cole Trapnell at the
      University of Maryland. Bowtie is an ultrafast, memory-efficient short
      read aligner. It aligns short reads to the human genome at a rate of 25
      million reads per hour on a typical workstation with 2 gigabytes of
      memory. Bowtie indexes the genome with a Burrows-Wheeler index to keep
      its memory footprint small: about 1.3 GB for the human genome. It
      supports alignment policies equivalent to Maq and SOAP, but at much
      greater speeds.

      Hi,

      I have no idea if its a right thread to ask this but any suggestion wrt my issue would be appreciated....

      I have a fasta file with 109 listed contigs. I am trying to align these contigs against a 3 MB reference genome. First I indexed my reference file and then I used the following command:

      ./bowtie2 -f -x proteobacter_SL1 -U 454AllContigs.fna -S halo_output_fasta --ignore-quals

      I got the following error:
      terminate called after throwing an instance of 'std::bad_alloc'
      what(): std::bad_alloc
      bowtie2-align died with signal 6 (ABRT)


      I have obtained my contig file with 109 contig from a 454 fastq file.
      When I tried this fastq against the same indexed reference (offcourse with changed basename), bowtie works perfect but as soon as i changed the tag to -f it throws error.

      Is it a memory problem?? coz the cotigs in the contigs file are quite big, close to 12K or 15K bp.

      any ideas???????

      Comment

      • mastal
        Senior Member
        • Mar 2009
        • 666

        #483
        Bowtie, an ultrafast, memory-efficient, open source short read aligner

        Have you looked at the 454AllContigs.fna file to check that it is in fasta format?
        If it is, -f should work.

        How much memory does the computer you're using have?

        Comment

        • kumarS_27
          Junior Member
          • Dec 2011
          • 7

          #484
          yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

          I am using a 12GB RAM PC.

          Comment

          • LizBent
            Member
            • Jan 2012
            • 31

            #485
            Originally posted by M4love View Post
            and I followed these instructions

            http://javastat.stat.wvu.edu/tcltk/Bowtie.html
            If you are unfamiliar with a Linux command line interface, this tutorial may help:



            If you still can't get Bowtie to work, I would find someone local to give you some lessons in how to use Linux and how to install and use Bowtie.

            Good luck!

            Comment

            • mastal
              Senior Member
              • Mar 2009
              • 666

              #486
              Originally posted by kumarS_27 View Post
              yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

              I am using a 12GB RAM PC.
              The amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.

              Can you monitor how much memory your PC is using before it produces the error?

              I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.

              Comment

              • M4love
                Junior Member
                • May 2013
                • 6

                #487
                Originally posted by dpryan View Post
                In the terminal, bowtie has nothing to do with R.
                Hey is there a small tutorial or a book which can teach me bowtie in general. I have read the tutorial which comes with the bowtie software. but that did not teach me the beginner things.
                I would really appreciate if there is a beginners guide or something. Could you please help me out. Thanks a lot.

                Comment

                • mastal
                  Senior Member
                  • Mar 2009
                  • 666

                  #488
                  Bowtie, an ultrafast, memory-efficient, open source short read aligner

                  Originally posted by M4love View Post
                  Hey is there a small tutorial or a book which can teach me bowtie in general. I have read the tutorial which comes with the bowtie software. but that did not teach me the beginner things.
                  I would really appreciate if there is a beginners guide or something. Could you please help me out. Thanks a lot.
                  Have you tried working through the examples in the Getting Started section of the Bowtie website?

                  Comment

                  • kumarS_27
                    Junior Member
                    • Dec 2011
                    • 7

                    #489
                    Originally posted by mastal View Post
                    The amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.

                    Can you monitor how much memory your PC is using before it produces the error?

                    I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.
                    Hi,

                    I checked the memory consumption by bowtie-align in the wrapping up stage and it was consuming CPU% 67 VIRT 173MB and RES 52MB, quite alot I would say...but this is with fastq format which was finished successfully. But when I used the fasta, it didnt even appeared in the terminal..and gave me the error.

                    Anyways, I try with chopping the long length contigs in to smaller one and then see..if it works, it will be clear that Bowtie does have an upper limit on the read length.

                    Comment

                    • kumarS_27
                      Junior Member
                      • Dec 2011
                      • 7

                      #490
                      Originally posted by kumarS_27 View Post
                      Hi,

                      I checked the memory consumption by bowtie-align in the wrapping up stage and it was consuming CPU% 67 VIRT 173MB and RES 52MB, quite alot I would say...but this is with fastq format which was finished successfully. But when I used the fasta, it didnt even appeared in the terminal..and gave me the error.

                      Anyways, I try with chopping the long length contigs in to smaller one and then see..if it works, it will be clear that Bowtie does have an upper limit on the read length.
                      I shortened the fasta contigs to 500-1000 and it worked well. I did not try to find a threshold as what upper limit contig length is accepted by Bowtie.

                      Thanks for suggestions.

                      Comment

                      • sinclaircooper
                        Junior Member
                        • Dec 2012
                        • 5

                        #491
                        Hi all, do any of you know if it is possible to change the matrix which bowtie2 uses for local alignment? If I actually have to alter the source code which part should I be looking at?

                        I'm trying to use a nucleotide identity matrix that counts T-C and G-A as being the same as T-T and G-G matches.

                        Comment

                        • dpryan
                          Devon Ryan
                          • Jul 2011
                          • 3478

                          #492
                          Originally posted by sinclaircooper View Post
                          Hi all, do any of you know if it is possible to change the matrix which bowtie2 uses for local alignment? If I actually have to alter the source code which part should I be looking at?

                          I'm trying to use a nucleotide identity matrix that counts T-C and G-A as being the same as T-T and G-G matches.
                          It sounds like you need to align bisulfite converted reads. If so, you can use bismark, which is a front-end for bowtie.

                          If you have access to a computer cluster and are comfortable compiling source code, I can also send you a program that I wrote that is similar to bismark, but 5-10x faster (just send me a message with your email address). I hope to post the bismark replacement that I wrote this week.

                          Comment

                          • sinclaircooper
                            Junior Member
                            • Dec 2012
                            • 5

                            #493
                            Hi thanks for the advice, the problem that I'm working on isn't acutally a bisuphate treated sample but now that you mention it I think the matrix I'm trying to use is fairly similar. However I need the matrix to allow TC/GA pairing on one 'direction' (i.e. Database to query) but not in the other: a t in the DB sequence can align to either a T or a c in the query...Is this tha same as a bisulphate alignemnt?

                            Thanks

                            Comment

                            • dpryan
                              Devon Ryan
                              • Jul 2011
                              • 3478

                              #494
                              Originally posted by sinclaircooper View Post
                              Hi thanks for the advice, the problem that I'm working on isn't acutally a bisuphate treated sample but now that you mention it I think the matrix I'm trying to use is fairly similar. However I need the matrix to allow TC/GA pairing on one 'direction' (i.e. Database to query) but not in the other: a t in the DB sequence can align to either a T or a c in the query...Is this tha same as a bisulphate alignemnt?

                              Thanks
                              Ah, treating the data as if it were bisulfite might not be the best approach, then. There, one typically in silico converts (for example all C's become T's) both the genome (database) and the read (query) prior to alignment to avoid biased alignments. Depending on what you're really trying to do (giving a bit more detail could prove helpful), this might be the more correct way to go, depending upon the exact underlying nature of your problem.

                              Should that not prove to be the best option, presumably bowtie (or any other aligner) could be modified. I'm not particularly familiar with its internals, so I couldn't point you toward the right place in the code to start making changes.

                              Comment

                              • sdm
                                Junior Member
                                • Oct 2009
                                • 9

                                #495
                                Hi all,

                                I have used bowtie in paired-end mode. When I checked the results I don't understand the following result:

                                these are 2 mates, as far as I understand two identical sequences (forward and reverse), which map to chromosome 6, if I map them individually (bowtie -m1 -v2)

                                1.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 0 chr6 72678938 255 77M * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT DDDDB9BFFFFF??C;ECFFFEHFFEEGHFGHGFHHHHHFFFGFCCACFHFHHHHHG-ECFBEEECE>>*5+CCHHH XA:i:1MD:Z:76C0 NM:i:1

                                2.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 16 chr6 72678938 255 77M * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT CAC-C5-,FFFCAA,C>+A5+-5-AA--CA+C7A9...A-A.EEA,FEAA../A..CC@+@+@@=<+@@==+<,,5, XA:i:1MD:Z:76C0 NM:i:1

                                however if I run
                                bowtie-0.12.7/bowtie --phred33-quals -X 2000 --fr --chunkmbs 300 -p 4 -a -v 2 --sam -q -1 1.fq -2 2.fq > paired.sam

                                the sequence pair is said to be either unmapped or with an insert size of -1109, it should be 0 in this case?

                                paired.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 1:N:0: 77 * 0 0 * * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT DDDDB9BFFFFF??C;ECFFFEHFFEEGHFGHGFHHHHHFFFGFCCACFHFHHHHHG-ECFBEEECE>>*5+CCHHH XM:i:0
                                raw.paired.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 147 chr6 72678938 255 77M = 72677906 -1109 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT CAC-C5-,FFFCAA,C>+A5+-5-AA--CA+C7A9...A-A.EEA,FEAA../A..CC@+@+@@=<+@@==+<,,5, XA:i:1 MD:Z:76C0 NM:i:1

                                If anybody has an idea what I have missed, I would be very grateful.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM
                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  07-09-2026, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 02:55 AM
                                0 responses
                                4 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-24-2026, 12:17 PM
                                0 responses
                                10 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-23-2026, 11:41 AM
                                0 responses
                                11 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-20-2026, 11:10 AM
                                0 responses
                                23 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...