Originally posted by M4love
View Post
Unconfigured Ad
Collapse
X
-
error with Bowtie
[QUOTE=Ben Langmead;2022]Hello all,
If you work with large genomes and large sets of short reads, please
take a look at Bowtie (http://bowtie-bio.sf.net), a new open source
short read aligner written by myself and Cole Trapnell at the
University of Maryland. Bowtie is an ultrafast, memory-efficient short
read aligner. It aligns short reads to the human genome at a rate of 25
million reads per hour on a typical workstation with 2 gigabytes of
memory. Bowtie indexes the genome with a Burrows-Wheeler index to keep
its memory footprint small: about 1.3 GB for the human genome. It
supports alignment policies equivalent to Maq and SOAP, but at much
greater speeds.
Hi,
I have no idea if its a right thread to ask this but any suggestion wrt my issue would be appreciated....
I have a fasta file with 109 listed contigs. I am trying to align these contigs against a 3 MB reference genome. First I indexed my reference file and then I used the following command:
./bowtie2 -f -x proteobacter_SL1 -U 454AllContigs.fna -S halo_output_fasta --ignore-quals
I got the following error:
terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
bowtie2-align died with signal 6 (ABRT)
I have obtained my contig file with 109 contig from a 454 fastq file.
When I tried this fastq against the same indexed reference (offcourse with changed basename), bowtie works perfect but as soon as i changed the tag to -f it throws error.
Is it a memory problem?? coz the cotigs in the contigs file are quite big, close to 12K or 15K bp.
any ideas???????
Comment
-
If you are unfamiliar with a Linux command line interface, this tutorial may help:Originally posted by M4love View Post
If you still can't get Bowtie to work, I would find someone local to give you some lessons in how to use Linux and how to install and use Bowtie.
Good luck!
Comment
-
The amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.Originally posted by kumarS_27 View Postyes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.
I am using a 12GB RAM PC.
Can you monitor how much memory your PC is using before it produces the error?
I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.
Comment
-
Hey is there a small tutorial or a book which can teach me bowtie in general. I have read the tutorial which comes with the bowtie software. but that did not teach me the beginner things.Originally posted by dpryan View PostIn the terminal, bowtie has nothing to do with R.
I would really appreciate if there is a beginners guide or something. Could you please help me out. Thanks a lot.
Comment
-
Bowtie, an ultrafast, memory-efficient, open source short read aligner
Have you tried working through the examples in the Getting Started section of the Bowtie website?Originally posted by M4love View PostHey is there a small tutorial or a book which can teach me bowtie in general. I have read the tutorial which comes with the bowtie software. but that did not teach me the beginner things.
I would really appreciate if there is a beginners guide or something. Could you please help me out. Thanks a lot.
Comment
-
Hi,Originally posted by mastal View PostThe amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.
Can you monitor how much memory your PC is using before it produces the error?
I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.
I checked the memory consumption by bowtie-align in the wrapping up stage and it was consuming CPU% 67 VIRT 173MB and RES 52MB, quite alot I would say...but this is with fastq format which was finished successfully. But when I used the fasta, it didnt even appeared in the terminal..and gave me the error.
Anyways, I try with chopping the long length contigs in to smaller one and then see..if it works, it will be clear that Bowtie does have an upper limit on the read length.
Comment
-
I shortened the fasta contigs to 500-1000 and it worked well. I did not try to find a threshold as what upper limit contig length is accepted by Bowtie.Originally posted by kumarS_27 View PostHi,
I checked the memory consumption by bowtie-align in the wrapping up stage and it was consuming CPU% 67 VIRT 173MB and RES 52MB, quite alot I would say...but this is with fastq format which was finished successfully. But when I used the fasta, it didnt even appeared in the terminal..and gave me the error.
Anyways, I try with chopping the long length contigs in to smaller one and then see..if it works, it will be clear that Bowtie does have an upper limit on the read length.
Thanks for suggestions.
Comment
-
Hi all, do any of you know if it is possible to change the matrix which bowtie2 uses for local alignment? If I actually have to alter the source code which part should I be looking at?
I'm trying to use a nucleotide identity matrix that counts T-C and G-A as being the same as T-T and G-G matches.
Comment
-
It sounds like you need to align bisulfite converted reads. If so, you can use bismark, which is a front-end for bowtie.Originally posted by sinclaircooper View PostHi all, do any of you know if it is possible to change the matrix which bowtie2 uses for local alignment? If I actually have to alter the source code which part should I be looking at?
I'm trying to use a nucleotide identity matrix that counts T-C and G-A as being the same as T-T and G-G matches.
If you have access to a computer cluster and are comfortable compiling source code, I can also send you a program that I wrote that is similar to bismark, but 5-10x faster (just send me a message with your email address). I hope to post the bismark replacement that I wrote this week.
Comment
-
Hi thanks for the advice, the problem that I'm working on isn't acutally a bisuphate treated sample but now that you mention it I think the matrix I'm trying to use is fairly similar. However I need the matrix to allow TC/GA pairing on one 'direction' (i.e. Database to query) but not in the other: a t in the DB sequence can align to either a T or a c in the query...Is this tha same as a bisulphate alignemnt?
Thanks
Comment
-
Ah, treating the data as if it were bisulfite might not be the best approach, then. There, one typically in silico converts (for example all C's become T's) both the genome (database) and the read (query) prior to alignment to avoid biased alignments. Depending on what you're really trying to do (giving a bit more detail could prove helpful), this might be the more correct way to go, depending upon the exact underlying nature of your problem.Originally posted by sinclaircooper View PostHi thanks for the advice, the problem that I'm working on isn't acutally a bisuphate treated sample but now that you mention it I think the matrix I'm trying to use is fairly similar. However I need the matrix to allow TC/GA pairing on one 'direction' (i.e. Database to query) but not in the other: a t in the DB sequence can align to either a T or a c in the query...Is this tha same as a bisulphate alignemnt?
Thanks
Should that not prove to be the best option, presumably bowtie (or any other aligner) could be modified. I'm not particularly familiar with its internals, so I couldn't point you toward the right place in the code to start making changes.
Comment
-
Hi all,
I have used bowtie in paired-end mode. When I checked the results I don't understand the following result:
these are 2 mates, as far as I understand two identical sequences (forward and reverse), which map to chromosome 6, if I map them individually (bowtie -m1 -v2)
1.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 0 chr6 72678938 255 77M * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT DDDDB9BFFFFF??C;ECFFFEHFFEEGHFGHGFHHHHHFFFGFCCACFHFHHHHHG-ECFBEEECE>>*5+CCHHH XA:i:1MD:Z:76C0 NM:i:1
2.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 16 chr6 72678938 255 77M * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT CAC-C5-,FFFCAA,C>+A5+-5-AA--CA+C7A9...A-A.EEA,FEAA../A..CC@+@+@@=<+@@==+<,,5, XA:i:1MD:Z:76C0 NM:i:1
however if I run
bowtie-0.12.7/bowtie --phred33-quals -X 2000 --fr --chunkmbs 300 -p 4 -a -v 2 --sam -q -1 1.fq -2 2.fq > paired.sam
the sequence pair is said to be either unmapped or with an insert size of -1109, it should be 0 in this case?
paired.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 1:N:0: 77 * 0 0 * * 0 0 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT DDDDB9BFFFFF??C;ECFFFEHFFEEGHFGHGFHHHHHFFFGFCCACFHFHHHHHG-ECFBEEECE>>*5+CCHHH XM:i:0
raw.paired.sam:MISEQ:2:000000000-A26AB:1:1101:17175:1762 147 chr6 72678938 255 77M = 72677906 -1109 GGACAATTAAAAAGCAACAACCACAATTAATACGGTTTACACAGGCAAAACTCATTAAGTGTGGGTTGGGGCGCTCT CAC-C5-,FFFCAA,C>+A5+-5-AA--CA+C7A9...A-A.EEA,FEAA../A..CC@+@+@@=<+@@==+<,,5, XA:i:1 MD:Z:76C0 NM:i:1
If anybody has an idea what I have missed, I would be very grateful.
Comment
Latest Articles
Collapse
-
by SEQadmin2
The immune system’s power comes from its genetic diversity, allowing myriad threats to be neutralized through first recognizing foreign antigens. That diversity is also what makes the immune system so difficult to study. Recent advances in sequencing technology and computational biology, however, are giving researchers new tools to understand immune responses and immune-related diseases in greater detail.
This convergence of genetics, immunology, and computation...-
Channel: Articles
09-01-2026, 05:41 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, 09-18-2026, 11:37 AM
|
1 response
33 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:04 AM
|
||
|
Started by SEQadmin2, 09-16-2026, 10:23 AM
|
1 response
48 views
0 reactions
|
Last Post
by pekgio
09-21-2026, 02:12 AM
|
||
|
Started by SEQadmin2, 09-09-2026, 12:14 PM
|
0 responses
69 views
0 reactions
|
Last Post
by SEQadmin2
09-09-2026, 12:14 PM
|
||
|
Started by SEQadmin2, 09-09-2026, 11:33 AM
|
0 responses
56 views
0 reactions
|
Last Post
by SEQadmin2
09-09-2026, 11:33 AM
|
Comment