[mastal]

yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

I am using a 12GB RAM PC.

The amount of memory would be plenty if you were mapping short reads to a 3 Mb genome, but with the very long contigs, I don't know.

Can you monitor how much memory your PC is using before it produces the error?

I know Bowtie2 is supposed to not have an upper limit for length of reads, but you might be better off using blast to map the contigs back to the reference genome.

[LizBent]

and I followed these instructions

http://javastat.stat.wvu.edu/tcltk/Bowtie.html

If you are unfamiliar with a Linux command line interface, this tutorial may help:

http://www.linfo.org/command_line_lesson_1.html

If you still can't get Bowtie to work, I would find someone local to give you some lessons in how to use Linux and how to install and use Bowtie.

Good luck!

[kumarS_27]

yes, its a proper fasta file...the only difference is, which I checked now..the contigs length are close to .3MB and the length gradually decreases till 109th contig.

I am using a 12GB RAM PC.

[mastal]

Bowtie, an ultrafast, memory-efficient, open source short read aligner

Have you looked at the 454AllContigs.fna file to check that it is in fasta format?
If it is, -f should work.

How much memory does the computer you're using have?

[kumarS_27]

error with Bowtie

[QUOTE=Ben Langmead;2022]Hello all,

If you work with large genomes and large sets of short reads, please
take a look at Bowtie (http://bowtie-bio.sf.net), a new open source
short read aligner written by myself and Cole Trapnell at the
University of Maryland. Bowtie is an ultrafast, memory-efficient short
read aligner. It aligns short reads to the human genome at a rate of 25
million reads per hour on a typical workstation with 2 gigabytes of
memory. Bowtie indexes the genome with a Burrows-Wheeler index to keep
its memory footprint small: about 1.3 GB for the human genome. It
supports alignment policies equivalent to Maq and SOAP, but at much
greater speeds.

Hi,

I have no idea if its a right thread to ask this but any suggestion wrt my issue would be appreciated....

I have a fasta file with 109 listed contigs. I am trying to align these contigs against a 3 MB reference genome. First I indexed my reference file and then I used the following command:

./bowtie2 -f -x proteobacter_SL1 -U 454AllContigs.fna -S halo_output_fasta --ignore-quals

I got the following error:
terminate called after throwing an instance of 'std::bad_alloc'
what(): std::bad_alloc
bowtie2-align died with signal 6 (ABRT)

I have obtained my contig file with 109 contig from a 454 fastq file.
When I tried this fastq against the same indexed reference (offcourse with changed basename), bowtie works perfect but as soon as i changed the tag to -f it throws error.

Is it a memory problem?? coz the cotigs in the contigs file are quite big, close to 12K or 15K bp.

any ideas???????

[dpryan]

Hey where should i type Bowtie
in the R software or in the terminal?

In the terminal, bowtie has nothing to do with R.

[M4love]

Hey where should i type Bowtie
in the R software or in the terminal?

and I followed these instructions

http://javastat.stat.wvu.edu/tcltk/Bowtie.html

[M4love]

Thanks a lot though. I really feel stupid

[M4love]

Did you follow the installation instructions? If you did, and were successful, you can type

bowtie

into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.

Hey where should i type Bowtie
in the R software or in the terminal?

[LizBent]

Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.

Did you follow the installation instructions? If you did, and were successful, you can type

bowtie

into the prompt and it will give you the help screen. If you were not, you will get an error. If you need help installing bowtie, find someone locally to help you. There are instructions on the website for how to install bowtie.

[M4love]

Hey I had a similar question. I have dowloaded bowtie latest version, but am new to use it. infact i am dumb enough not to know how to open it or use it. I extracted the file and am trying to open it in "terminal" and even R non of it is working.

[Tobias Kockmann]

-m parameter in "end-to-end" mode

Dear Bowtie developers/users,

I have seen the following line of code in a Nature protocol for aligning 36 bp quality-pre-filtered ChIP-seq reads to the Drosophila genome. I was asking myself, if they are really sensible:

bowtie -q -m 1 -v 3 --best --strata

As I under stood from the Bowtie publication, -v mode will create "end-to-end" hits, but totally ignores quality information. The alignment ranking is therefor purely based on the number of mismatches (stratum). Since the max. number of mismatches is set to 3, valid alignments will be allowed to contain up to 3 mismatched position over the complete 36mer. The reporting option -m 1 means that Bowtie will only report an alignment, if the read is unique.

Lets assumes the following scenarios for a single read:

a.)
alignment a, perfect match
alignment b, 1 mismatched position

Bowtie will report a, right?

b.)
alignment a, perfect match
alignment b, perfect match

Bowtie will report no match for the read, since both valid alignments have the same rank.

But, what do the options --best and --strata trigger in "end-to-end" mode??? Do they do anything?

Greetings,
Tobi

[Dario1984]

Any plans to implement --best and --strata for paired-end mode ? I get a lot less reads mapping with -v 3 -m 1 because it isn't present.

[rsinha]

Bowtie2: How to reproduce example alignment

I am running Bowtie2 to reproduce the example mentioned in the Manual but all in vain. Here is the example I am trying to reproduce:
End-to-end alignment example

Read: GACTGGGCGATCTCGACTTCG
Reference: GACTGCGATCTCGACATCG

Alignment:
Read: GACTGGGCGATCTCGACTTCG
|| || | || || || |||| || ||
Reference: GACTG--CGATCTCGACATCG

I will be glad if someone let me know what parameters were used to find above alignment. OR someone who is able to do it

[LizBent]

Hi, Bowtie noob question here. I have some paired read data where there are unpaired reads (that is, these reads were removed in preprocessing because they were too short, so that there are sequences in read1.fastq that are not present in read2.fastq, and vice versa). Can I use this with Bowtie, or should I go back to the raw data and re-process it (to remove primers and adapters) this time without removing any sequences? The data was originally prepared for use with Trinity, which supports unpaired reads in paired end data.