[Xi Wang]

Seems its a bug of Bowtie2. Probably you may report it to the developers.

[amaer]

But the read IS mappable (1 mismatch only for 36 bp)! And I can see that when I increase M. I mean, with M 1, it did not map anywhere on the human genome, but it did so when I increased M (keeping all other parameters constant - N, L, i etc. And when I use -a (all) alignments option I get tens of alignments. I find that very strange.
I expect that regardless of the M value, at least one of the alignments would be reported, not necessarily the best one.

[Xi Wang]

It seems that it has nothing to do with M if a read is not mappable. Because in this mode, "The search terminates when it can't find more distinct valid alignments, or when it finds M+1 distinct alignments, whichever happens first." As the read is unmappable, the searching will always ends up with the former condition, no matter whatever M is.

[amaer]

the M option in Bowtie2 beta1.3

Hi,

I have a question about the use of the M parameter in Bowtie2 beta1.3. I understand it's the number of valid, distinct alignments found for each read (M+1 actually). And reports only 1, the best alignment of THOSE examined.

If a read maps to multiple places, in human genome for example, I expect that Bowtie2 to possibly have different best alignment reported for different M values.

Is it possible to have a 36 bp read NOT mapped at all (to human genome) with M =1, but mapped in other places with a higher values for M? If yes, why?

Thanks!

[gntc]

Duplicate outputs

I have some reads that were reported to map to hg19 uniquely (only one place in the genome) but they have two lines of output. The two lines are completely identical. This happened for many reads. Has anyone else had this problem?

[ymc]

Is this the right way to use bowtie to align reads from an 1000 genome sample (e.g. NA18526) to the human genome?

First, I downloaded three files from 1000genomes
ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz
ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz
ftp://ftp.1000genomes.ebi.ac.uk/vol1....filt.fastq.gz

I downloaded the hg19 index files from
ftp://ftp.cbcb.umd.edu/pub/data/bowt...g19.ebwt.1.zip
ftp://ftp.cbcb.umd.edu/pub/data/bowt...g19.ebwt.2.zip

Unzipped them and put them in the indexes subdirectory.

Then I run the following command on my dual hex-core machine with 48GB RAM:

time ./bowtie -p 12 --chunkmbs 200 -S hg19 -1 NA18526/ERR031854_1.filt.fastq -2 NA18526/ERR031854_2.filt.fastq NA18526.sam

It took about 65min to finish. Am I doing it right?

What is the use of the small ERR031854.filt.fastq at 1000genomes.org??

Thanks a lot in advance!

[niteesh.prasad]

Bowtie-Output

Hey! I am running the bowtie aligner on about 1000 files and storing the results in .map files. I want to save the timing results in the output files as well. Any idea how to do this? Thanks a lot!

[rfrancis]

No worries Xi Wang. Thanks for your help.
I just submitted this as a bug on their sourceforge site (ID: 3496148). There's also a similar report there too so I know it's not just me having this problem! Hopefully they can fix this easily.
Regards,
Rich

[Xi Wang]

Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
Regards,
Rich

Sorry Rich. I have run a test on you test data, and found that --fullref only applied to reference sequences. If there are no solutions bowtie can provide, you may (i) first edit your fq files to remove any spaces in IDs, or (ii) use other tools. I know exactly that GSNAP can keep spaces in IDs when mapping RAN-seq reads.

[rfrancis]

Thanks Xi Wang. I just gave that a go on my test data but I still get the read that matches the reference having a truncated ID. Looks like this option (--fullref) only applies to the reference sequence name and not the readID. Any chance someone could replicate this?
Regards,
Rich

[Xi Wang]

There is an option in Bowtie v0.12.7: --fullref, which can make the output file contain the entire names.

Dear all,
Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

SRR064286.51418

However when no match is found the ID is reported in full.

This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

Many thanks in advance.

Reads: Save as test.fq
@SRR064286.10 HWI-EAS418:1:4:1:147 length=50
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
+SRR064286.10 HWI-EAS418:1:4:1:147 length=50
BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
@SRR064286.11 HWI-EAS418:1:4:1:119 length=50
GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
+SRR064286.11 HWI-EAS418:1:4:1:119 length=50
BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
>testref
ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

Thanks for your help
Rich

[rfrancis]

Bowtie truncates ID line if it has spaces

Dear all,
Has anyone seen this before? I am using bowtie v0.12.7 to align reads from the short read archive which have IDs as follows:

SRR064286.51418 HWI-EAS418:1:5:1357:1070 length=50

In the resultant SAM file where bowtie finds a match, for some reason the ID is truncated to the first space:

SRR064286.51418

However when no match is found the ID is reported in full.

This seems odd, so I would appreciate someone trying to replicate this for me. Below are a couple of reads and a very short sequence to use as a reference. The first read should match but the other should not. Can someone try and align these using bowtie and let me know what you get.

Many thanks in advance.

Reads: Save as test.fq
@SRR064286.10 HWI-EAS418:1:4:1:147 length=50
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
+SRR064286.10 HWI-EAS418:1:4:1:147 length=50
BCBCCCCCCCCA8::>:?:>8!/@:1&7>6@BCBA@CACCA6>!<BB<BA
@SRR064286.11 HWI-EAS418:1:4:1:119 length=50
GGTTGTAGGACAGCATTTCAAGAACTAAACAGAGATGGTTTCGGAACATA
+SRR064286.11 HWI-EAS418:1:4:1:119 length=50
BBABA@BAABB:3707::9</!.B>:76:8;B9BAAAB>BBC<!<BCBB?

Ref: Save as ref.fa and run "bowtie-build ref.fa ref" to make a reference
>testref
ATTTCGATGCGAGCTTATTCGAGGCGTATCGTAGCGAGTGCTAGGGCTAT
TGGCTTCTTCTGTCTTCATAAGTTTTTCCAGGCGGTCTTCCAAGTCCAAA
GCGGATTGCTGATGCGAGCGTAGTCGTAGTGTGCGTATTGCGATTCGATG

Run bowtie with "bowtie --sam ref test.fq test.sam" and check out the SAM file test.sam.

Thanks for your help
Rich

[Nick]

Apparently, it is normal that some reads are skipped because they can't align. Just hope the percentage that is skipped isn't too high!

I know this thread is quite old, but just wanted to point out this is not normal.

http://sourceforge.net/tracker/index.php?func=detail&aid=3049179&group_id=236897&atid=1101606

The search tree is exceeding the default available memory.

[mediator]

mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.

Yes, my data was RNA-Seq. Thanks for the advice! Do you think -X will help?

[biznatch]

mediator, are you using Bowtie to align RNA-Seq data? You should use Tophat for RNA-Seq data, as Bowtie can't deal with splice sites, which would be why you're getting a low alignment percentage.