[Xi Wang]

I see. Is there a way to get around this problem (other than using another alignment program)? Thanks.

You may use the option:

-5/--trim5 <int> trim <int> bases from 5' (left) end of reads

such as "-5 1"

[James]

Index problem

Hi,

I've been using an index I created for a while now and just realized that the index is only for about half of the fastq file I wanted.

So I carried out bowtie-inspect and I get this:

bowtie-inspect -s indexes/cds
Colorspace 0
SA-Sample 1 in 32
FTab-Chars 10
assert_eq: expected (5320, 0x14c8) got (2526, 0x9de)
bowtie_inspect.cpp:218
Assertion failed: (0), function print_index_summary, file bowtie_inspect.cpp, line 218.
Abort trap


I have no idea how to go about fixing this. So any help would be much appreciated.

Thanks, J

Edit: I Fixed this by splitting up the FASTA file and building multiple indexes.

[genetic]

Usual workstation OK?

Hi all,
I have tried running Bowtie on a PC with 300 GB disc, 2.66 GHz, 1.98 GB RAM. It says "out of memory allocating [ebwt] array for the Bowtie index".
I want to map using the human hg18 genome. Are there some hints to run it on such PC or I really need more memory?
Thanks.

[axiom7]

Disparate results between -m1 and -a

Hi,

I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

Two things don't make sense to me:

1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

Of course all runs specify -I700 -X1300.

Thanks.
Susan

[sdvie]

best alignment for paired-end reads

Dear all,

I am quite intrigued with Bowtie and the options it offers.
When trying to figure out the best settings for my application, the following question arose:

According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

Many thanks for your comments!
Sophia

[Xi Wang]

Dear all,

I am quite intrigued with Bowtie and the options it offers.
When trying to figure out the best settings for my application, the following question arose:

According to the manual, the --best and --strata options do not apply when aligning paired-end reads. So how can I sort the valid alignments that are produced and - if I want to output only one alignment/read - how do I make sure that it is the "best" one?

using the -m 1 -v 2 options, I would only output one (any?) read that has up to 2 mm, right?
alternatively, using -m 1 -n 0 , I could be more stringent setting lower -l and -e values, but still, I would not have a ranking in the "--best" sense?

Many thanks for your comments!
Sophia

I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.

[sdvie]

best alignment for paired-end reads

I think it's hard for bowtie to combine best single end alignment. Also it's hard to define the best alignment for paired-end reads.

Thanks for the comment. I realized that I actually made a mistake asking my question with the indicated parameters, since '-m 1' automatically reduces the output to reads with "unique" alignments, meaning that there is no sorting necessary.
The question would rather be if I use the '-a' all alignment output option, whether then there would be a possibility to sort the achieved alignments.

cheers,
Sophia

[axiom7]

More on disparate results between -a vs -m1

Hi again,

Have not gotten any reply to my posting, so I thought I'd make it a little easier for you. I am pasting the --12, 10-line input file and the two commands which quickly and easily reproduce my (perhaps perceived) problem. Again, the reference sequence is human chromosome 1.

Here are the two commands (assuming the --12 file is named x.12.fa and that the reference index is named hschr1):

bowtie -t -f --ff -I700 -X1300 -v0 -y -m1 hschr1 --12 x.12.fa
bowtie -t -f --ff -I700 -X1300 -v0 -y -a hschr1 --12 x.12.fa

And here is x.12.fa:

>0000000000 GAAGCTGAGGTGGGAGGATC IIIIIIIIIIIIIIIIIIII GCTAGGCGTGGTGGCTGGGA IIIIIIIIIIIIIIIIIIII
>0000000001 CCTGGTTCCTGGCACAGAGC IIIIIIIIIIIIIIIIIIII AGGCTGGTCTCAAACTCCTG IIIIIIIIIIIIIIIIIIII
>0000000002 GGAATTTTGTTCTTGCTCAT IIIIIIIIIIIIIIIIIIII GAGCAGTTAAAACAGTTGCT IIIIIIIIIIIIIIIIIIII
>0000000003 CCATAATATCTAGCCTGTAG IIIIIIIIIIIIIIIIIIII AACTACTGAAAAATTTTGAA IIIIIIIIIIIIIIIIIIII
>0000000004 GAACTCATCATTTTTTATGG IIIIIIIIIIIIIIIIIIII CATTGCTTTTGTCCCACCGA IIIIIIIIIIIIIIIIIIII
>0000000005 ATTCATATTGCTACTGAAAT IIIIIIIIIIIIIIIIIIII AGTCCATGAGTGCAGGGAAA IIIIIIIIIIIIIIIIIIII
>0000000006 AGAAAAGGCCAAACTCTGGA IIIIIIIIIIIIIIIIIIII AAAAAAAAGAAGAAGAAGAG IIIIIIIIIIIIIIIIIIII
>0000000007 GATGAAGACCACAGCATCAA IIIIIIIIIIIIIIIIIIII CATGTGTCTGCGCCTGCGCC IIIIIIIIIIIIIIIIIIII
>0000000008 ATGGTTCTTAGCTAGATTCA IIIIIIIIIIIIIIIIIIII GTTGTGTATATTTATCTCTT IIIIIIIIIIIIIIIIIIII
>0000000009 AGCTGAAAAATGGTTGAACC IIIIIIIIIIIIIIIIIIII TGGCTATGTGGGCTCTTTTT IIIIIIIIIIIIIIIIIIII

Thanks.
Susan

Hi,

I have some paired end data generated from human chromosome 1. Pairs are between 700 and 1300 bases apart. I have cut 10 pairs from the overall data to run some tests to try and understand what bowtie is doing, as the researcher is really only interested in unique pairs.

When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m. The reads that align are numbers 1,3,4,5,7,8,9.

However when I run bowtie with -a --ff -v0 -y, bowtie reports that all 10 reads align and in addition, it shows multiple alignments for reads 1 and 8.

Two things don't make sense to me:

1. Why does bowtie say that one read does not align at all when I specify -m1 and then report alignments for all 10 pairs when I specify -a?

2. Why does bowtie report reads for pairs 1 and 8 for the -m1 run, when it shows multiple alignments for those pairs when I specify -a?

Of course all runs specify -I700 -X1300.

Thanks.
Susan

[genetic]

Dummy question

Dear all,

I have tried running bowtie for the first time. I run it with the following parameters: ./bowtie -t -3 5 -p 8 hg19 reads/my_reads_file.txt hg19.map

However after the program has finished calculating, I do not see the output file. A second puzzling thing is that it writes to the screen that only ~1% of my reads mapped to the genome. Do you have any ideas what is wrong?

Thank you!

[axiom7]

More on disparate results between -a vs -m1

Hi all,
I thought I asked a reasonable question...
Susan

[sdvie]

Hi all,
I thought I asked a reasonable question...
Susan

Hi Susan,

I am still a beginner in using Bowtie, but here go some suggestions and comments:

1. The x.12.fa is your input file, right? Have you tried to separate the two reads of the pairs into two separate files and then run the mapping? Why are you pasting the input sequences here, I thought you had doubts about the alignment results?

2. Have you tried each of these reads separately, lets say with the -a option?

When I run bowtie with -m1 --ff -v0 -y parameters, bowtie reports that there are 7 reads with at least one reported alignment, 1 read failed to align, and 2 reads were suppressed due to -m.

3. As far as I understand, -m1 only reports reads with exactly one alignment, not at least one alignment.

[axiom7]

Regarding the disparate -m1 vs -a

Thanks for a reply,

I posted the input reads so that someone could run bowtie using that input against human chromosome #1 and see the results for themselves, as it is so small and easily done.

I HAVE run the same input using two input fasta files and the results are identical. Easier to post the contents of the --12 file.

bowtie output tells you how many reads were "suppressed" due to the -m setting so the fact that pairs 1, 8 show up with -m1 and then show up multiple alignments with -a is not expected behavior as I understand it.

It's a good idea to run each pair by itself. I'll try that and see if it enlightens me further.

Thanks again.
Susan

[dcfargo]

Please help with genome reseq parameter suggestion for PE 100mer data (D. melanogaster)

What are people going with as the 'default' alignment parameters/workflow?

I'm wondering if people are using -x and if so what value? Is it better to allow for structural variations with a large -x value or to even leave it out?

Is using -m1 and --max part of the workflow?

Also what combination of -l/-n/-e do people find works well with PE 100mers? Obviously it depends on data quality.

[kweber2]

Can anyone tell me what this warning means? I can't find any documentation for it:

"Warning: Exhausted best-first chunk memory for read IPAR1:1:11:15296:1878:1#0/1 (patid 2434682); skipping read"

Thanks for any help!

-Kris

[edchen]

I'm running Bowtie for the first time and I keep getting:

Out of memory allocating the ebwt[] array for the Bowtie index. Please try
again on a computer with more memory.

I'm using the hg19 index and am running on a 32-bit system with 4 GB of memory. I've tried to reduce the memory usage with offrate, but it doesn't seem to help.

I've even gone so far as to boot into safe mode to use the command prompt with low memory use, and I don't see bowtie allocate anymore than 890 MB of memory.