Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • malcook
    Member
    • Sep 2009
    • 24

    Warning: Exhausted best-first chunk memory for read

    when I get this message I have found that the following option makes it go away (doubling the default value)

    --chunkmbs 128

    Comment

    • david2
      Member
      • May 2010
      • 19

      Out of memory with me as well

      Hi,
      I am also getting:
      C:\bowtie-0.12.5>bowtie -c hg18 ATTCAGTAGGTACTATAAATGGCCGAT --chunkmbs 512
      Out of memory allocating the ebwt[] array for the Bowtie index. Please try
      again on a computer with more memory.
      Command: bowtie -c --chunkmbs 512 hg18 ATTCAGTAGGTACTATAAATGGCCGAT

      I tried the chunkmbs with 32, 128, 256 and 512 on a winXP32bit with 4GB of RAM, the maximum allocated memory is around 1.2 GB. Any other ideas I could try?
      Thanks a lot,

      David

      --edit--:
      I rebooted the system, the task manager shows at least 3.6G of total phys. memory, 2.7GB available and 1.6G cache, I am still getting the request to use a 'computer with more memory'. I thought Bowtie was supposed to run on the human genome with ~ 2GB of RAM?
      --edit2--:
      I got it to work under a VMWare virtual machine running Ubuntu on the above XP system, without any chunkmbs setting, there is definitely something fishy when running under XP
      Last edited by david2; 08-26-2010, 12:06 PM. Reason: Added more info about the system... works under VMWare/Ubuntu

      Comment

      • seqniru
        Junior Member
        • Oct 2010
        • 5

        Hi,
        I am just starting to use Linux and Bowtie so this might be something simple.
        I downloaded Bowtie and just wanted to run the example suggested in the tutorial.
        I am giving the command
        chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq
        I get an error that says chmod cannot access e_coli No such file or directory.
        Can't figure out what is wrong.
        Help appreciated!
        Thanks.

        Comment

        • mrawlins
          Member
          • Apr 2010
          • 63

          The command

          chmod ugo+rwx bowtie e_coli reads/e_coli_1000.fq

          will change permissions (chmod)
          for the user, group and others (ugo)
          to include reading, writing and executing permissions (+rwx)
          for the files bowtie, e_coli and reads/e_coli_1000.fq

          The error is that it can't find a file or directory named e_coli. That will be relative to the directory you are running the command from, so you should try
          ls
          and see if there are any files named e_coli.

          If your filename has a space in it (not recommended) you should be able to put a \ before the space, which should keep the command from thinking you're listing a new file. You could also put the filename with a space in single or double quotes, which may help that same problem.

          Hope that helps.

          Comment

          • seqniru
            Junior Member
            • Oct 2010
            • 5

            Thank you mrawlins.
            That was very helpful. I finally got bowtie up and running.

            Comment

            • seqniru
              Junior Member
              • Oct 2010
              • 5

              Hi All,
              Still trying to figure out Bowtie options.
              How do I get it to align reads allowing more than 3 mismatches?
              Thanks.

              Comment

              • gzentner
                Junior Member
                • Jun 2010
                • 5

                seqniru,

                You might try -v <int>. This ignores quality values and allows up to <int> mismatches. I don't think there's a limit on it, like with -n only going up to 3 mismatches

                I also have a question of my own. I am trying to align some data using Bowtie and keep getting an error:

                Reads file contained a pattern with more than 1024 quality values.
                Please truncate reads and quality values and and re-run Bowtie
                terminate called after throwing an instance of 'int'
                Aborted

                I have looked for solutions to this and tried some but nothing seems to work. My reads and quality strings are the same length, -v does not work.

                Here is a file head:

                @IL2_1423:1:49:708:540
                GTCTCTTTCTTTTAGATGAA
                +
                >>>>>>>>>>>>>>>>>>>>

                I am not sure if this has something to do with the quality string being all >? Any help is appreciated! Thanks.

                Comment

                • seqniru
                  Junior Member
                  • Oct 2010
                  • 5

                  Thank you gzentner.
                  I tried -v but it does not work with number greater than 3 either.

                  Comment

                  • seqniru
                    Junior Member
                    • Oct 2010
                    • 5

                    Still looking for answer to this question.
                    How do I get it to align reads allowing more than 3 mismatches?
                    Both -n and -v can only be set to a maximum of 3 mismatches.
                    Thanks.

                    Comment

                    • Chipper
                      Senior Member
                      • Mar 2008
                      • 323

                      -n 3 allows more mismatches if seed length is less than read length. For more mismatches in the seed you need another aligner like Bfast.

                      Comment

                      • alvin
                        Junior Member
                        • Oct 2010
                        • 9

                        Reverse complement matches

                        I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
                        My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
                        eg:
                        B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
                        B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

                        I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
                        I don't know if there is an option for this.
                        I'm running bowtie with these parameters:
                        bowtie -v3 -a -m3 --best --strata -p4 -t -S

                        Thanks in advance
                        Best regards


                        alv

                        Comment

                        • Xi Wang
                          Senior Member
                          • Oct 2009
                          • 317

                          Hi alv,

                          "To align the reverse complement of the reads" is equivalent "to align the reads to the reverse complement of the reference genome", and the alignment results are the same. You can BLAST or BLAT the read to check the given results.


                          Originally posted by alvin View Post
                          I have some questions about mapping Illumina reads to a genome with bowtie and I really appreciate if you could help me.
                          My reads are single read and strand-specific, so I did the alignment with bowtie and I realised that there were a lot of reads that aligned to the genome but they were transformed into the reverse complement.
                          eg:
                          B1:000000010#0x37397/1 16 chr3 281135 255 22M * 0 0 TGCCGACTTCCCTGAGTGTACC
                          B1:000000010#0x37397/1 0 chr4 375688 255 22M * 0 0 GGTACACTCAGGGAAGTCGGCA

                          I would like to align the reads to the forward and the reverse complement of the reference genome but I don't want to align the reverse complement of the reads.
                          I don't know if there is an option for this.
                          I'm running bowtie with these parameters:
                          bowtie -v3 -a -m3 --best --strata -p4 -t -S

                          Thanks in advance
                          Best regards


                          alv
                          Xi Wang

                          Comment

                          • masylichu
                            Member
                            • Oct 2010
                            • 30

                            Hi, all
                            I am newer for using the bowtie program to map the short reads.
                            could someone give me what the parameters (--best --strata -m) stand?

                            Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.

                            thanks.

                            Comment

                            • alvin
                              Junior Member
                              • Oct 2010
                              • 9

                              @Xi Wang

                              Thank you for your response. You are absolutely right!
                              Best Regards

                              Originally posted by masylichu View Post
                              Hi, all
                              I am newer for using the bowtie program to map the short reads.
                              could someone give me what the parameters (--best --strata -m) stand?
                              Have you taken a look at the bowtie's Manual?



                              Originally posted by masylichu View Post
                              Hi, all
                              Because when map the short reads to reference genome with the default parameter, in my surprise, there is low ratio.
                              What are the optimal parameters?

                              Depends on the objective of your sequencing and technology that you are using, each one has different cons. E.g. Illumina tend to introduce mismatches in general terms. Roche 454 tend to introduce indels, etc.
                              Try with -y and -a.
                              Hope this help

                              Comment

                              • alvin
                                Junior Member
                                • Oct 2010
                                • 9

                                M1

                                I realized that the -m and -M options are not compatible.
                                I think it would be useful if we could use both parameters at the same time.
                                E.g.
                                If we run the program with this parameters
                                $ ./bowtie -a -m3 --best --strata

                                Specifying -m 3 instructs bowtie to refrain from reporting any alignments for reads having more than 3 reportable alignments, --best , best-to-worst order and
                                specifying --strata in addition to -a and --best causes bowtie to report only those alignments having the least number of mismatches...but what if some read maps twice or three times with the same numer of mismatches?
                                Bowtie will report all the alignments for this read because they pass the -a -m3 --best --strata filters, so, I think it would be useful if we could add the -M1 option. Then only one alignment (random) will be informed when this happens, so in this way leading to the "uniqness".

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                                  by SEQadmin2



                                  Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                                  ...
                                  Yesterday, 11:10 AM
                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  07-08-2026, 05:17 AM
                                • GATTACAT
                                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by GATTACAT
                                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                  07-01-2026, 11:43 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Yesterday, 10:04 AM
                                0 responses
                                10 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-08-2026, 10:08 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-07-2026, 11:05 AM
                                0 responses
                                12 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                31 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...