Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bioinfosm
    replied
    not the optimum mapping of a read

    Thanks Ben, setting it that way worked.

    But why don't I get the optimum alignment, that is seen using blat! Even using the -a option gives sub-optimal hits..

    Here is the real read with Q values, that ended up unmapped
    @HWI-E4:1:87:1633:1127#0/1
    CGTGTAAGTTAAGACTTCCCAAGTTTGTTCAAGGCTGCAGTCTCTTCTTCTCAGTTTTATATGGAAAAGCAGACT
    +
    B427?@?=@@>07?@ABBBB@?<>AB=4@B?<+/B42@82;A?A<4.,@:6<)9:<8(0998(-/;A=3%%%%%%

    HTML Code:
    $  /home/m049157/build/bowtie-0.10.0/bowtie --best 
    -p 4 -t -e 90 -n 3 zv7scaffold w ww
    Time loading forward index: 00:00:01
    Time loading mirror index: 00:00:01
    Seeded quality full-index search: 00:00:00
    Reported 1 alignments to 1 output stream(s)
    Time searching: 00:00:02
    Overall time: 00:00:02
    
    $ cat ww
    HWI-E4:1:87:1633:1127#0/1       +       Zv7_scaffold1183        139472  CGTGTAAGTTAAGACTTCCCAAGTTTGTTCAAGGCTGCAGTCTCTTCTTCTCAGTTTTATATGGAAAAGCAGACT     B427?@?=@@>07?@ABBBB@?<>AB=4@B?<+/B42@82;A?A<4.,@:6<)9:<8(0998(-/;A=3%%%%%%     0      18:G>C,27:A>T,57:G>T,68:C>G,69:A>C,70:G>A,71:A>G,72:C>A,74:G>T
    
    
    -- removing -n 3
    $  /home/m049157/build/bowtie-0.10.0/bowtie --best -p 4 -t -e 90 zv7scaffold w ww
    $ cat ww
    HWI-E4:1:87:1633:1127#0/1       -       Zv7_scaffold724 463363  AGTCTGCTTTTCCATATAAAACTGAGAAGAAGAGACTGCAGCCTTGAACAAACTTGGGAAGTCTTAACTTACACG     %%%%%%3=A;/-(8990(8<:9)<6:@,.4<A?A;28@24B/+<?B@4=BA><?@BBBBA@?70>@@=?@?724B     0       18:C>G,27:T>A,57:C>A,68:G>C,69:T>G,70:A>T,71:T>C,72:G>T,74:C>A
    
    
    -- using -a to report all aln
    $  /home/m049157/build/bowtie-0.10.0/bowtie --best -p 4 -t -e 90 -a zv7scaffold w ww
    $ cat ww
    HWI-E4:1:87:1633:1127#0/1       -       Zv7_scaffold724 463363  AGTCTGCTTTTCCATATAAAACTGAGAAGAAGAGACTGCAGCCTTGAACAAACTTGGGAAGTCTTAACTTACACG     %%%%%%3=A;/-(8990(8<:9)<6:@,.4<A?A;28@24B/+<?B@4=BA><?@BBBBA@?70>@@=?@?724B     0       18:C>G,27:T>A,57:C>A,68:G>C,69:T>G,70:A>T,71:T>C,72:G>T,74:C>A
    HWI-E4:1:87:1633:1127#0/1       +       Zv7_scaffold1183        139472  CGTGTAAGTTAAGACTTCCCAAGTTTGTTCAAGGCTGCAGTCTCTTCTTCTCAGTTTTATATGGAAAAGCAGACT     B427?@?=@@>07?@ABBBB@?<>AB=4@B?<+/B42@82;A?A<4.,@:6<)9:<8(0998(-/;A=3%%%%%%     0      18:G>C,27:A>T,57:G>T,68:C>G,69:A>C,70:G>A,71:A>G,72:C>A,74:G>T
    HWI-E4:1:87:1633:1127#0/1       -       Zv7_scaffold2650        169222  AGTCTGCTTTTCCATATAAAACTGAGAAGAAGAGACTGCAGCCTTGAACAAACTTGGGAAGTCTTAACTTACACG     %%%%%%3=A;/-(8990(8<:9)<6:@,.4<A?A;28@24B/+<?B@4=BA><?@BBBBA@?70>@@=?@?724B     0      18:C>G,27:T>A,57:C>A,68:G>C,69:T>G,70:C>T,71:T>C,72:G>T,73:A>G,74:T>A
    
    Thanks,
    Last edited by bioinfosm; 11-30-2009, 01:14 PM.

    Leave a comment:


  • Ben Langmead
    replied
    Originally posted by bioinfosm View Post
    <bump>

    any comments?
    Looks like the -e ceiling is exceeded. When input is provided via -c, qualities are assumed to be 'I' (which, rounded, becomes Phred 30). So try -e 90 or higher.

    Ben

    Leave a comment:


  • bioinfosm
    replied
    <bump>

    any comments?

    Leave a comment:


  • bioinfosm
    replied
    bowtie missed read mapped by blat

    I am confused about this read being missed by bowtie. Did I miss something here

    Here is the blat result on reference sequence
    HTML Code:
    BLASTN 2.2.11 [blat]
    
    Reference:  Kent, WJ. (2002) BLAT - The BLAST-like alignment tool
    
    Query= read
             (75 letters)
    
    Database: Zv7_scaffolds.fa 
               7494 sequences; 1,440,319,812 total letters
    
    Searching.done
                                                                     Score    E
    Sequences producing significant alignments:                      (bits) Value
    
    Zv7_scaffold910                                                       132   5e-31
    Zv7_scaffold910                                                       128   9e-30
    ...
    
    >Zv7_scaffold910 
              Length = 7751464
    
     Score = 132 bits (341), Expect = 5e-31
     Identities = 72/75 (96%)
     Strand = Minus / Plus
    
    Query: 75      agtctgcttttccatataaaactgagaagaagagactgcagccttgaacaaacttgggaa 16
                   ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||
    Sbjct: 5660145 agtctgcttttccatataaaactgagaagaagagactgcagccttgatcaaacttgcgaa 5660204
    
    Query: 15      gtcttaacttacacg 1
                   |||| ||||||||||
    Sbjct: 5660205 gtctgaacttacacg 5660219


    While this is what bowtie reports

    HTML Code:
    $ /home/m049157/build/bowtie-0.10.0/bowtie --best -n 3 -p 4 -t zv7scaffold -c CGTGTAAGTTAAGACT
    TCCCAAGTTTGTTCAAGGCTGCAGTCTCTTCTTCTCAGTTTTATATGGAAAAGCAGACT
    Time loading forward index: 00:00:16
    Time loading mirror index: 00:00:16
    Seeded quality full-index search: 00:00:01
    No results
    Time searching: 00:00:33
    Overall time: 00:00:33

    Leave a comment:


  • ramouz87
    replied
    Originally posted by Ben Langmead View Post
    Hi ramouz,

    I guess I'm not too familiar with how other tools set these fields. Are they typically set by the user? I.e., should I add a command-line option where the user can specify values for ID, SM, etc.?

    Thanks,
    Ben
    Hi Ben
    I'm trying to run some structural variation programs such BreakDancer, Pindel, ... and seems that problem is due to missing info in the header. I guess that there's no other choice than specifing the header manually so would be a good idea to add that option.
    I guess effort should focus on a standard format to avoid compatibility problem.
    Thanks Ben.

    Leave a comment:


  • pythonlovesbowtie
    replied
    How to limite the reported read length?

    Hello everybody. Not sure how to address my question. I mean, bowtie will skip reads that are less than 4 characters. How can I make it skip reads less than 5 or 6 or more? Can I set that?

    Thanks very much!

    Leave a comment:


  • amaer
    replied
    concise mode and speed

    Originally posted by Ben Langmead View Post
    (...) piping its output to a tool like awk or by wrapping the bowtie invocation it in a perl script or something similar. That's far more flexible than relying solely on Bowtie's output mode. Here's a simple example where read sequences and qualities are suppressed but the output is otherwise identical:
    (...)
    It's likely that I'll deprecate --concise mode in a future release, so writing a script or a wrapper to postprocess Bowtie's output is highly recommended.

    Hope that helps,
    Ben
    Thanks a lot, Ben, that's very helpful. I have noticed that in my case running in the --concise mode is MUCH faster than the full mode (more than twice as fast). I don't mind using indexes instead of real IDs that much, but you do 'lose' the mismatch information. a concise mode with the mismatch information added would be nice.

    I also noticed that if I have for example a target of 1 million Genbank sequences of 20Kb each, if I concatenate them in a single Fasta sequence before building the index it speeds up the run by about 15-20%.

    Leave a comment:


  • Ben Langmead
    replied
    Originally posted by ramouz87 View Post
    Is there a way to have @RG header when generating the sam output file with bowtie ?
    Hi ramouz,

    I guess I'm not too familiar with how other tools set these fields. Are they typically set by the user? I.e., should I add a command-line option where the user can specify values for ID, SM, etc.?

    Thanks,
    Ben

    Leave a comment:


  • Ben Langmead
    replied
    Originally posted by amaer View Post
    I would have liked to have the option of reading a zipped/gzipped file since that's how we receive the data from Solexa sequencing provider. Besides, the FASTQ files are quite big, and I'd prefer to leave them uncompressed, rather than decompress them for analysis and then recompress them. But I can certainly understand your point.
    To be clear, I am suggesting a solution to your problem; just not one that builds gzip into Bowtie, which is my preference.

    Originally posted by amaer View Post
    In the mean time, I have a few more questions/suggestions? about the output. I had 20 million Solexa 36mer reads run against a division of Genbank (lots of redundancy obviously) and got a huge output file - over 100 GB. It took over 3 hrs on 8 CPUs (64 bit) (I ran it with the options -a --best --strata -n 2).

    1. Could we have the option that in the outfile we don't print the read sequence and/or quality score? or other ways to reduce the size of the output file, while not being quite "concise" style?
    2. In the 'concise' mode, could we print the NAME (e.g. gi/accession up to the 1st whitespace) of the reference sequence, instead of the index?
    If the size of the output is a problem and not all of the information output by Bowtie is needed, I would strongly suggest a strategy of postprocessing bowtie's default output, perhaps by piping its output to a tool like awk or by wrapping the bowtie invocation it in a perl script or something similar. That's far more flexible than relying solely on Bowtie's output mode. Here's a simple example where read sequences and qualities are suppressed but the output is otherwise identical:

    $ ./bowtie -u 10 e_coli reads/e_coli_1000.fq | awk -v OFS="\t" '{print $1,$2,$3,$4,$7,$8}'
    # reads processed: 10
    # reads with at least one reported alignment: 7 (70.00%)
    # reads that failed to align: 3 (30.00%)
    Reported 7 alignments to 1 output stream(s)
    r0 - gi|110640213|ref|NC_008253.1| 3658049 0 32:T>G,34:G>A
    r1 - gi|110640213|ref|NC_008253.1| 1902085 0
    r2 - gi|110640213|ref|NC_008253.1| 3989609 0
    r5 + gi|110640213|ref|NC_008253.1| 4249841 0
    r7 + gi|110640213|ref|NC_008253.1| 4086913 0
    r8 + gi|110640213|ref|NC_008253.1| 2679194 0 14:A>T,33:C>G
    r9 - gi|110640213|ref|NC_008253.1| 2430559 0
    It's likely that I'll deprecate --concise mode in a future release, so writing a script or a wrapper to postprocess Bowtie's output is highly recommended.

    Hope that helps,
    Ben

    Leave a comment:


  • ramouz87
    replied
    @RG Header

    Hi Ben,
    Is there a way to have @RG header when generating the sam output file with bowtie ?
    Thanks in advance.

    Leave a comment:


  • amaer
    replied
    eliminating redundancy from the output

    Originally posted by Ben Langmead View Post
    Hi Andreia,

    This is the first time I've heard that requested. Of course, it's easy to pipe or 'tee' bowtie's output directly to gzip; (...) To me, delegating zipping and unzipping to external programs is vastly preferable to building it into Bowtie, since it enables a multitude of compression formats without unnecessarily complicating Bowtie or detracting from its portability. So I'm unlikely to build that into Bowtie unless I hear many more people ask for it.

    Let me know if the suggestions don't work or if you'd like be to send you the paired-end script.

    Thanks,
    Ben
    Thanks, Ben, I would have liked to have the option of reading a zipped/gzipped file since that's how we receive the data from Solexa sequencing provider. Besides, the FASTQ files are quite big, and I'd prefer to leave them uncompressed, rather than decompress them for analysis and then recompress them. But I can certainly understand your point.

    In the mean time, I have a few more questions/suggestions? about the output. I had 20 million Solexa 36mer reads run against a division of Genbank (lots of redundancy obviously) and got a huge output file - over 100 GB. It took over 3 hrs on 8 CPUs (64 bit) (I ran it with the options -a --best --strata -n 2).

    1. Could we have the option that in the outfile we don't print the read sequence and/or quality score? or other ways to reduce the size of the output file, while not being quite "concise" style?
    2. In the 'concise' mode, could we print the NAME (e.g. gi/accession up to the 1st whitespace) of the reference sequence, instead of the index?

    Thanks,
    Andreia

    Leave a comment:


  • Ben Langmead
    replied
    Hi Andreia,

    Originally posted by amaer View Post
    Hi Ben, Thanks for the update. Do you have an estimate about when Bowtie would be able to handle gzipped files for input and output?

    Thanks,
    Andreia
    This is the first time I've heard that requested. Of course, it's easy to pipe or 'tee' bowtie's output directly to gzip; e.g.:

    $ ./bowtie -u 10 e_coli reads/e_coli_1000.fq | gzip -c > alns.gz
    # reads processed: 10
    # reads with at least one reported alignment: 7 (70.00%)
    # reads that failed to align: 3 (30.00%)
    Reported 7 alignments to 1 output stream(s)
    $ gzip -dc alns.gz
    r0 - gi|110640213|ref|NC_008253.1| 3658049 ATGCTGGAATGGCGATAGTTGGGTGGGTATCGTTC 45567778999:9;;<===>?@@@@AAAABCCCDE 0 32:T>G,34:G>A
    r1 - gi|110640213|ref|NC_008253.1| 1902085 CGGATGATTTTTATCCCATGAGACATCCAGTTCGG 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r2 - gi|110640213|ref|NC_008253.1| 3989609 CATAAAGCAACAGTGTTATACTATAACAATTTTGA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r5 + gi|110640213|ref|NC_008253.1| 4249841 CAGCATAAGTGGATATTCAAAGTTTTGCTGTTTTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r7 + gi|110640213|ref|NC_008253.1| 4086913 GCATATTGCCAATTTTCGCTTCGGGGATCAGGCTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r8 + gi|110640213|ref|NC_008253.1| 2679194 GGTTCAGTTCAGTATACGCCTTATCCGGCCTACGG EDCCCBAAAA@@@@?>===<;;9:99987776554 0 14:A>T,33:C>G
    r9 - gi|110640213|ref|NC_008253.1| 2430559 GCCTGTTCGGCGTTGAGGGTAATGAAATCATCGCC 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    For unpaired input, it's also possible to pipe 'gzip -dc's output directly to bowtie and specify '-' (meaning "standard in") as the input file. E.g.:

    $ head -40 reads/e_coli_1000.fq | gzip -c > tmpreads.gz
    $ gzip -dc tmpreads.gz | ./bowtie e_coli -
    r0 - gi|110640213|ref|NC_008253.1| 3658049 ATGCTGGAATGGCGATAGTTGGGTGGGTATCGTTC 45567778999:9;;<===>?@@@@AAAABCCCDE 0 32:T>G,34:G>A
    r1 - gi|110640213|ref|NC_008253.1| 1902085 CGGATGATTTTTATCCCATGAGACATCCAGTTCGG 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r2 - gi|110640213|ref|NC_008253.1| 3989609 CATAAAGCAACAGTGTTATACTATAACAATTTTGA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r5 + gi|110640213|ref|NC_008253.1| 4249841 CAGCATAAGTGGATATTCAAAGTTTTGCTGTTTTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r7 + gi|110640213|ref|NC_008253.1| 4086913 GCATATTGCCAATTTTCGCTTCGGGGATCAGGCTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r8 + gi|110640213|ref|NC_008253.1| 2679194 GGTTCAGTTCAGTATACGCCTTATCCGGCCTACGG EDCCCBAAAA@@@@?>===<;;9:99987776554 0 14:A>T,33:C>G
    r9 - gi|110640213|ref|NC_008253.1| 2430559 GCCTGTTCGGCGTTGAGGGTAATGAAATCATCGCC 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    # reads processed: 10
    # reads with at least one reported alignment: 7 (70.00%)
    # reads that failed to align: 3 (30.00%)
    Reported 7 alignments to 1 output stream(s)
    But paired-end reads, unfortunately, generally come as two separate files. Bowtie supports a simple alternative format for paired-end reads (1 pair per line, tab-delimited fields are read name, mate 1 sequence, mate 1 qualities, mate 2 sequence, mate 2 qualities) which is enabled with the --12 option. If the reads are in that format and you use the --12 option, you can again pipe the output of 'gzip -dc' and use '-' as the input file. I have a script (that I'll include in the next Bowtie release) that converts a pair of (perhaps gzipped) FASTQ files into that format. That script's output can be conveniently piped to Bowtie e.g.:

    $ gzip -c reads/e_coli_1000_1.fq > tmp1.fq.gz
    $ gzip -c reads/e_coli_1000_2.fq > tmp2.fq.gz
    $ perl scripts/fastq_to_tabbed.pl -1 tmp1.fq.gz -2 tmp2.fq.gz | ./bowtie -u 10 --12 - e_coli
    r0/2 + gi|110640213|ref|NC_008253.1| 2963701 GAATACTGGCGGATTACCGGGGAAGCTGGAGC EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r0/1 - gi|110640213|ref|NC_008253.1| 2963907 CTGACCGGCAGGAGTATGAAGGATGCGGAAGAATA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r1/2 + gi|110640213|ref|NC_008253.1| 4118712 AATGTGAAAACGCCATCGATGGAACAGGCAAT EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r1/1 - gi|110640213|ref|NC_008253.1| 4118838 GGCGTAGATGTCGGCGCGAAAAAAGAGATCTATCA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r2/2 + gi|110640213|ref|NC_008253.1| 4158419 AACGCGCGTTATCGTGCCGGTCCATTACGCGG EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r2/1 - gi|110640213|ref|NC_008253.1| 4158521 CGCTCAGGGCGTGATGTCCACTTACAAAGGGCGTG 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r3/1 + gi|110640213|ref|NC_008253.1| 2116984 CGATGCAGATGCGTACCACCTGGACCAGGCCTTTC EDCCCBAAAA@@@@?>===<;;9:99987776554 2
    r3/2 - gi|110640213|ref|NC_008253.1| 2117146 CGTTTATCTGGCTGTTTATCCGACGCCCGAAA 67778999:9;;<===>?@@@@AAAABCCCDE 2
    r4/2 + gi|110640213|ref|NC_008253.1| 1796722 GCACAACATCGGGAGGGTAAGATTTGTGACGA EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r4/1 - gi|110640213|ref|NC_008253.1| 1796883 CACTTCAGCCGCCACTTCTGGCACCAGCAAAGTCA 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r5/2 + gi|110640213|ref|NC_008253.1| 136755 ATGGCCGCACTTGTAGAGCTGCTGAAAAACCC EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r5/1 - gi|110640213|ref|NC_008253.1| 136879 TGGCTGCTGTCGCCAAAGGCGAAGCTAAATCCCCG 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r6/2 + gi|110640213|ref|NC_008253.1| 2717264 CCCATTTCCGCGTCTCAAATAATTTGCTGGAG EDCCCBAAAA@@@@?>===<;;9:99987776 0
    r6/1 - gi|110640213|ref|NC_008253.1| 2717443 AACAGATAAAAAGCCTGGGTCAGCGCCGTATACGC 45567778999:9;;<===>?@@@@AAAABCCCDE 0
    r7/1 + gi|110640213|ref|NC_008253.1| 1073149 GTATCGCTGTTTTCCAGTTGTTCAAGATAAGAAAA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r7/2 - gi|110640213|ref|NC_008253.1| 1073350 TGATGTTGCAACTTTGTGCAACCGTGTTAAAT 67778999:9;;<===>?@@@@AAAABCCCDE 0
    r8/1 + gi|110640213|ref|NC_008253.1| 177630 CCACGGTTGATGCTGGCATCGCTGATTGGTGCGTT EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r8/2 - gi|110640213|ref|NC_008253.1| 177789 AGCATTAGCGCGCCGGATATGAAGGTGAACGA 67778999:9;;<===>?@@@@AAAABCCCDE 0
    r9/1 + gi|110640213|ref|NC_008253.1| 1642197 GCGCCTTAATGCGCTACTCCACCAGCAATTACGTA EDCCCBAAAA@@@@?>===<;;9:99987776554 0
    r9/2 - gi|110640213|ref|NC_008253.1| 1642268 TCAACTGGCCCTCACCGCCAGATGCCACGCGA 67778999:9;;<===>?@@@@AAAABCCCDE 0
    # reads processed: 10
    # reads with at least one reported alignment: 10 (100.00%)
    # reads that failed to align: 0 (0.00%)
    Reported 10 paired-end alignments to 1 output stream(s)
    To me, delegating zipping and unzipping to external programs is vastly preferable to building it into Bowtie, since it enables a multitude of compression formats without unnecessarily complicating Bowtie or detracting from its portability. So I'm unlikely to build that into Bowtie unless I hear many more people ask for it.

    Let me know if the suggestions don't work or if you'd like be to send you the paired-end script.

    Thanks,
    Ben

    Leave a comment:


  • amaer
    replied
    Gzipped files?

    Hi Ben, Thanks for the update. Do you have an estimate about when Bowtie would be able to handle gzipped files for input and output?

    Thanks,
    Andreia

    Originally posted by Ben Langmead View Post
    Hi amaer,

    Perhaps by end-of-year. It's very hard to say because most of my time goes to collaborators, and they don't have predictable schedules . But by end-of-year is a reasonable guess.

    Thanks,
    Ben

    Leave a comment:


  • ramouz87
    replied
    Originally posted by Ben Langmead View Post
    Hi Ramzi,

    The options you're looking for are almost certainly -I/-X and --ff/--fr/--rf. You need to have a reasonably good idea of the expected insert size and specify an appropriate range with -I/-X. You should also confirm that your paired-end protocol produces pairs in the fw/rev orientation. This is the typical configuration for Illumina. If your paired-end data has a different orientation, change it with --ff or --rf.

    Hope that helps,
    Ben
    Hi Ben,
    thanks for your reply, Indeed setting the -X parameter to 5000 and the orientation to (--rf [although it's the standard illumina paired end protocol]) and clipping 24 pair on the reverse sequence lead to 52.35% :
    #bowtie -t -p 16 -X 5000 --rf ./ref/h_sapiens_37_asm -1 ./fastq/s_8_1_sequence.fq -2 ./fastq/s_8_2_sequence_50b.fq ./align/pronest_5000_rf_2_50b.bowtie.align --un ./unalign/pronest_5000_rf_2_50b.unalign.fq
    # reads with at least one reported alignment: 3486518 (52.35%)
    # reads that failed to align: 3173993 (47.65%)
    Do you think alignment could be improved further ?
    thanks again for help and congratulation for the good work.
    Regards,
    Ramzi

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by liu3zhen View Post
    Sorry for the confusing question.
    If I specify -k 4 --best, multiple alignments will be reported even one best hit is found. I'm wondering is it possible only the best hit (only 1) is report for this case, rather than 4 alignments reported in best-to-worst order.
    Maybe you can specify the option "-m 1". Then all the multiple reads will not be reported.

    Leave a comment:

Latest Articles

Collapse

  • mylaser
    Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by mylaser
    Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
    If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
    This guide explains everything you need to know about...
    07-11-2026, 01:13 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-09-2026, 10:04 AM
0 responses
23 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-08-2026, 10:08 AM
0 responses
14 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-07-2026, 11:05 AM
0 responses
33 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-02-2026, 11:08 AM
0 responses
31 views
0 reactions
Last Post SEQadmin2  
Working...