Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts

  • dukevn
    replied
    bowtie options

    Hi collective brains,

    I am getting confused with some Bowtie's options. I did read the manual carefully and also read most of the reads in this thread, but still confused.

    * What is difference between -m and -M? From the manual, it seems to me that -M is equivalent to -m --best --strata?

    * What option I should use to filter out matches from repeated reads?

    Thanks,

    D.

    Leave a comment:


  • Thomas Doktor
    replied
    kevpar, you need to start Bowtie from a terminal.
    In windows hit the windows-key+R and type "cmd" then hit run, in Ubuntu start a terminal via Programs>Accessories>Terminal.
    If you have installed Bowtie in your path you can simply type "Bowtie" and hit enter, otherwise go to the path where you installed Bowtie first.

    Running Bowtie with no arguments will give you a manual page describing which options are available. An easier way is to examine the online Bowtie manual at http://bowtie-bio.sourceforge.net/manual.shtml .

    Leave a comment:


  • RichEast
    replied
    Originally posted by mskonan View Post
    Hi All,
    I got the same error "Reads file contained a pattern with more than 1024 quality values." with Bowtie 0.12.3
    My data have 76bp / the same length in quality:
    ILLUMINA-1A5BF1 1 8 61 12450 2086 0 1 TGCTGCGCTGTGATTTCTCGCTGGCAGACTTGGGTTGGCTTTGCTGAGGGGACGTGAGACATTGTATCAGGGGCCA bbbbbbbbbbbbbbbbbbbbbbbbbbbcbcbbbbbbbbbbbbbbbbbbb`bbbIbbbb_bbbbabbb]bbbbbbbb 1

    After I convert them to fastq format (76/76) like this:
    @ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    TAGGAGGGTGACCTGAAGAGTGGAAGGAAGAGTCAGGAATACTCAGAAGAACCTGTGCATATAGGCCAGGCCCGAC
    +ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    aaaa_aaaaaaaaaa]aaYaaaaaaaa_`a_a_a_aaXaa_a`[_aa_`N`aa_`]a]`aXHVV]a`^X]YQHYVa

    I got the error.
    I guess that the count difference between sequence and quality might not matter for the error.

    It'd be greatly appreciated if someone can help me.

    Cheers,

    KJ
    mskonan,

    We actually found that we missed some reads in our initial filtering for removing reads with multiple uncalled bases (denoted with "."). It seems that if the read has multiple uncalled bases this is a problem for bowtie and it gives the "Reads file contained a pattern with more than 1024 quality values" error. Once these are removed the program works fine with the same file command.

    rich

    Leave a comment:


  • kevpar
    replied
    Ben,

    I have just downloaded Bowtie and can't get it to run. A window opens for bowtie.exe, but then quickly closes down again. This occurs in both Ubuntu and Windows. I suspect I am missing something simple, but would appreciate your help.

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by mskonan View Post
    Hi All,
    I got the same error "Reads file contained a pattern with more than 1024 quality values." with Bowtie 0.12.3
    My data have 76bp / the same length in quality:
    ILLUMINA-1A5BF1 1 8 61 12450 2086 0 1 TGCTGCGCTGTGATTTCTCGCTGGCAGACTTGGGTTGGCTTTGCTGAGGGGACGTGAGACATTGTATCAGGGGCCA bbbbbbbbbbbbbbbbbbbbbbbbbbbcbcbbbbbbbbbbbbbbbbbbb`bbbIbbbb_bbbbabbb]bbbbbbbb 1

    After I convert them to fastq format (76/76) like this:
    @ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    TAGGAGGGTGACCTGAAGAGTGGAAGGAAGAGTCAGGAATACTCAGAAGAACCTGTGCATATAGGCCAGGCCCGAC
    +ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    aaaa_aaaaaaaaaa]aaYaaaaaaaa_`a_a_a_aaXaa_a`[_aa_`N`aa_`]a]`aXHVV]a`^X]YQHYVa

    I got the error.
    I guess that the count difference between sequence and quality might not matter for the error.

    It'd be greatly appreciated if someone can help me.

    Cheers,

    KJ
    I guess the program just does not recognize the sign for carriage return?

    Leave a comment:


  • mskonan
    replied
    The difference between sequence and quality might not matter for the error

    Originally posted by Ben Langmead View Post
    Hi Rich,

    Another user just contacted me via email and described something similar. When I ran their reads through bowtie, I realized that part of the problem is that Bowtie is printing the wrong error message. In their case, the error message should have been something more like "Too many quality values for read..." because they had a fastq entry where the quality string was 2 characters longer than the sequence string. Do you notice any inconsistencies like that in your input?

    I'll fix the error-message bug.

    Thanks,
    Ben
    Hi All,
    I got the same error "Reads file contained a pattern with more than 1024 quality values." with Bowtie 0.12.3
    My data have 76bp / the same length in quality:
    ILLUMINA-1A5BF1 1 8 61 12450 2086 0 1 TGCTGCGCTGTGATTTCTCGCTGGCAGACTTGGGTTGGCTTTGCTGAGGGGACGTGAGACATTGTATCAGGGGCCA bbbbbbbbbbbbbbbbbbbbbbbbbbbcbcbbbbbbbbbbbbbbbbbbb`bbbIbbbb_bbbbabbb]bbbbbbbb 1

    After I convert them to fastq format (76/76) like this:
    @ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    TAGGAGGGTGACCTGAAGAGTGGAAGGAAGAGTCAGGAATACTCAGAAGAACCTGTGCATATAGGCCAGGCCCGAC
    +ILLUMINA-1A5BF1:8:1:1303:18887#0/1
    aaaa_aaaaaaaaaa]aaYaaaaaaaa_`a_a_a_aaXaa_a`[_aa_`N`aa_`]a]`aXHVV]a`^X]YQHYVa

    I got the error.
    I guess that the count difference between sequence and quality might not matter for the error.

    It'd be greatly appreciated if someone can help me.

    Cheers,

    KJ
    Last edited by mskonan; 03-11-2010, 06:32 PM.

    Leave a comment:


  • RichEast
    replied
    Originally posted by Ben Langmead View Post
    Hi Rich,

    Another user just contacted me via email and described something similar. When I ran their reads through bowtie, I realized that part of the problem is that Bowtie is printing the wrong error message. In their case, the error message should have been something more like "Too many quality values for read..." because they had a fastq entry where the quality string was 2 characters longer than the sequence string. Do you notice any inconsistencies like that in your input?

    I'll fix the error-message bug.

    Thanks,
    Ben
    Ben,

    That seems to be a likely problem. We took the first 20 or so paired reads and verified the sequence and quality value lengths, and that ran well, with the same command line. We'll go through the FASTQ files and try and find the quality string causing us problems. Thanks to everyone for the helpful suggestions.

    rich

    Leave a comment:


  • Ben Langmead
    replied
    Originally posted by RichEast View Post
    We're using Bowtie version 0.12.3, with the command line (running on a command prompt in windows) "Bowtie -n 2 -q --solexa1.3-quals -S Pbindex -1QN_read1 -2QN_read2 QNalign.sam" The FASTQ files are run off a Illunima GA II pipeline 1.4. Thanks.

    rich
    Hi Rich,

    Another user just contacted me via email and described something similar. When I ran their reads through bowtie, I realized that part of the problem is that Bowtie is printing the wrong error message. In their case, the error message should have been something more like "Too many quality values for read..." because they had a fastq entry where the quality string was 2 characters longer than the sequence string. Do you notice any inconsistencies like that in your input?

    I'll fix the error-message bug.

    Thanks,
    Ben

    Leave a comment:


  • Xi Wang
    replied
    Originally posted by RichEast View Post
    We're using Bowtie version 0.12.3, with the command line (running on a command prompt in windows) "Bowtie -n 2 -q --solexa1.3-quals -S Pbindex -1QN_read1 -2QN_read2 QNalign.sam" The FASTQ files are run off a Illunima GA II pipeline 1.4. Thanks.

    rich
    Could you please paste a head of your data as the bowtie input here?

    Leave a comment:


  • RichEast
    replied
    Originally posted by Ben Langmead View Post
    Can you please post the Bowtie version you're using, and the command you used to run it?

    Thanks,
    Ben
    We're using Bowtie version 0.12.3, with the command line (running on a command prompt in windows) "Bowtie -n 2 -q --solexa1.3-quals -S Pbindex -1QN_read1 -2QN_read2 QNalign.sam" The FASTQ files are run off a Illunima GA II pipeline 1.4. Thanks.

    rich

    Leave a comment:


  • acnoll
    replied
    Originally posted by RichEast View Post
    Hello everyone,

    We have been using MAQ for our Solexa assembly needs, but we're moving to another program for downstream analysis, and Bowtie seems much easier for upstream assembly. Unfortunately, this means learning another assembly program. I was trying to assemble some data that we have previously assembled and analyzed using MAQ using Bowtie and I'm running into an error I don't really understand. It states "Reads file contained a pattern with more than 1024 quality values." I'm using the -n alignment mode to assemble the paired alignments (and including the input option --solexa-quals), but have also tried in -v alignment mode (which I thought ignored quality values). We didn't have any issues assembling this data with MAQ, so I think I'm just missing something being new to Bowtie. Any help anyone can provide would be greatly appreciated.

    Thanks
    I have seen this error when the number of bases does not equal the number of quality values in the fastq file. Assuming that isn't the problem it most likely has something to do with bowtie expecting a range of quality values that are not present in your fastq file. Which version of the Illumina pipeline did this data come from?

    Leave a comment:


  • Ben Langmead
    replied
    Can you please post the Bowtie version you're using, and the command you used to run it?

    Thanks,
    Ben

    Leave a comment:


  • RichEast
    replied
    Bowtie quality values error

    Hello everyone,

    We have been using MAQ for our Solexa assembly needs, but we're moving to another program for downstream analysis, and Bowtie seems much easier for upstream assembly. Unfortunately, this means learning another assembly program. I was trying to assemble some data that we have previously assembled and analyzed using MAQ using Bowtie and I'm running into an error I don't really understand. It states "Reads file contained a pattern with more than 1024 quality values." I'm using the -n alignment mode to assemble the paired alignments (and including the input option --solexa-quals), but have also tried in -v alignment mode (which I thought ignored quality values). We didn't have any issues assembling this data with MAQ, so I think I'm just missing something being new to Bowtie. Any help anyone can provide would be greatly appreciated.

    Thanks

    Leave a comment:


  • bloomfi1
    replied
    Originally posted by Ben Langmead View Post
    Hi,

    Yes, the problem was that versions < 0.12.2 were failing to check for a too-high input for -n and -v. The manual and the usage message both said max=3, but bowtie erroneously didn't enforce it.

    Note that the -n option only constrains the number of mismatches in the seed, not in the entire alignment. The key is to set -n, -l and -e to reasonable numbers given your data. Since your reads are 75bp, I would suggest trying a few different settings, perhaps starting with -l 28 (the default) -n 2 and -e 180 and then adjusting all 3 until your getting your desired mix of speed and sensitivity.

    Thanks,
    Ben
    Hello and thank you for the advice. I am wondering about the maximum setting of 3, though. I have looked at the bowtie source a little bit and get the impression that this restriction is possibly an inherent restriction in the overall design of bowtie. Is this accurate? Otherwise, do you have any plans to increase this number in the future?

    Thank you,
    Sean

    Leave a comment:


  • shoncho
    replied
    I am fairly new to the field of next-gen sequencing but find Bowtie to be fairly user friendlybut I do have a question regarding its use. What is the difference in reporting between the default bowtie and the use of the -a, --strata, and --best flags? I understand that with the flags all of the alignments are reported in a best to work format but what does the default bowtie report? For human sequencing data is there a best set of parameters to use in order to gain enough sensitivity in coverage while keeping the file sizes to a manageable number?
    thanks in advance for any help.

    Leave a comment:

Latest Articles

Collapse

  • SEQadmin2
    Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
    by SEQadmin2



    CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

    Despite this, “CRISPR helped turn genome editing from a specialized technique into
    ...
    07-31-2026, 11:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, Yesterday, 10:05 AM
0 responses
9 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-13-2026, 12:22 PM
0 responses
36 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-11-2026, 10:35 AM
0 responses
30 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 08-06-2026, 07:41 AM
0 responses
39 views
0 reactions
Last Post SEQadmin2  
Working...