Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • dmacmillan
    Member
    • Jan 2012
    • 49

    #1

    Pysam Fetching Incorrect Coordinates

    Hello everyone. I am using pysam to fetch the reads overlapping a given region, however, I am finding that pysam returns a list of reads whose positions do not correspond with the region coordinates that I input. The BAM file is indexed with samtools index 'file.bam'

    For example, I want to fetch this region: chr3:50617849-50618103

    I do so with the following code (inside python command line):
    Code:
    import pysam
    bam = pysam.AlignmentFile('file.bam')
    reads = bam.fetch('chr3',50617849,50618103)
    for read in reads:
        print read.pos
    The first coordinate printed is 50335428, which is outside the scope of my input region completely.

    Does anybody know why this is happening? The BAM file was created from a STAR alignment of paired-end reads against the hg19 human reference genome in case that matters.
  • dpryan
    Devon Ryan
    • Jul 2011
    • 3478

    #2
    Right, but does the read stretch into or span that region? You're not asking for reads starting in that interval, you're asking for those that intersect it in any way (including splicing over it).

    Comment

    • dmacmillan
      Member
      • Jan 2012
      • 49

      #3
      Well the distance from that read to the actual start location is ~280,000 nucleotides. I suppose then the read would have to be spliced? Here is one of the reads in question:

      Code:
      ABC-ST978_0126:2:1307:16045:21543#0     403     2       50335428 3
              91M317386N10M   2       50335207        101     GGGGTCTGTAACCACCAGGTCTATAAAACAGCCGACCCAATCTACTTGCTGGCCTTCTGTCTTCCAGTAGTCCTCCTAGTCCACCACTAGGAGGACTAGGA       array('B', [66, 66, 66, 64, 66, 66, 66, 65, 63, 64, 64, 66, 66, 66, 66, 65, 66, 66, 66, 66, 66, 67, 66, 65, 66, 66, 66, 66, 66, 66, 66, 68, 68, 70, 70, 72, 72, 71, 72, 71, 71, 71, 69, 70, 72, 71, 71, 72, 71, 70, 70, 71, 72, 72, 72, 72, 72, 71, 71, 71, 72, 71, 71, 72, 72, 72, 72, 71, 72, 71, 69, 72, 71, 69, 72, 71, 71, 72, 72, 72, 71, 70, 70, 72, 70, 69, 72, 72, 70, 70, 70, 70, 70, 68, 66, 68, 68, 68, 65, 64, 64])    [('NH', 2), ('HI', 2), ('AS', 189), ('nM', 0)]
      I suppose that 317386N region is the gap?

      Comment

      • dpryan
        Devon Ryan
        • Jul 2011
        • 3478

        #4
        Yup, it's a spliced read, which you can tell from the N cigar operator.

        Comment

        • dmacmillan
          Member
          • Jan 2012
          • 49

          #5
          Interesting, glad I know this now. Thanks!

          Comment

          • dpryan
            Devon Ryan
            • Jul 2011
            • 3478

            #6
            No problem, I've been tripped up by this as well. In case you ever use the pileup() functions, keep in mind that this will happen there as well.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
              by SEQadmin2



              CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

              Despite this, “CRISPR helped turn genome editing from a specialized technique into
              ...
              07-31-2026, 11:01 AM
            • SEQadmin2
              Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
              by SEQadmin2


              Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

              The systematic characterization of the human proteome has
              ...
              07-20-2026, 11:48 AM
            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 10:13 AM
            0 responses
            13 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-31-2026, 02:55 AM
            0 responses
            27 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-24-2026, 12:17 PM
            0 responses
            20 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-23-2026, 11:41 AM
            0 responses
            19 views
            0 reactions
            Last Post SEQadmin2  
            Working...