Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • guilhem
    Member
    • Feb 2016
    • 10

    #16
    Thanks for all of your advices!
    I did not know about BBMap software, thank you!
    Is it faster as Hisat2? I have billions of read to map, although I think I will try for now to restrict my mapping to the transcriptome (especially for Eukarotic genome) -- full genome is very slow.

    Comment

    • GenoMax
      Senior Member
      • Feb 2008
      • 7142

      #17
      If you have a multi-core machine, BBMap will be fast. Use the threads=N option to start with available threads.

      Comment

      • zorgster
        Junior Member
        • May 2018
        • 1

        #18
        Originally posted by Brian Bushnell View Post
        Normally, I use the defaults But for 30bp ribosomal reads, you could add "maxindel=10" (just a random small number I picked). Searching for long indels (which BBMap does by default) is not necessary when aligning to ribosomes (which as far as I know are never spliced); [...]

        [...] with any mismatches, or quality-trim to Q30 prior to mapping, etc. These are almost never good ideas! They are typically devised by biologists on the assumption that "My data has variable quality, and is annotated with its actual quality. Therefore, if I throw away low-quality data, my results will be strictly better."
        I was here for adapter clipping. But thought I'd add something to this old post:

        1. https://www.ncbi.nlm.nih.gov/books/NBK21729/ (Molecular Cell Biology) summarises:
        - "Like pre-mRNAs, the primary transcripts produced from pre-rRNA and tRNA genes undergo extensive processing." - some of the processes are described in the linked chapter. Some things to be aware of if aligning to rRNA...

        2. Low quality reads... I have just such reads to back this up... what does Q2 mean here? The reads line up - but the sequence was still read where the quality was #/Q2. To me that looks like a valid read. [Read ID anonymised to SRR888888]

        @SRR888888.19.1 19 length=76
        CCCCCATGGAGCACAGGCAGACAGAAGCCCCCGCCCCAGCTCTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGC
        +
        =<7<=<AABCBBABB3?+<A<B>@A###################################################
        @SRR888888.20.1 20 length=76
        CCCCATGGAGCACAGGCAGACAGAAGTCCCCGCCCCAGCTGTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGCT
        +
        @@@DDBDDF?BBF?FE=EE1CFDCFHBC<CEFDFA@@F>AGDG@FEHE>EEH>=CCED?CCCC<@@@@CCACCCA@
        @SRR888888.29.1 29 length=76
        CAGCTGTGTGGCCTCAAGCCAGCCTTCCGCTCCTTGAAGCTGGTCTCCACACAGTGCTGGTTCCGTCACCCCCTCC
        +
        @@@FFFDE<DFHBAGGEGIHIB@GIIIGIIAHIGIIIGIGHGCHIIIIICFH;FHGGIII@C=?AEHBBCBCCCCC


        Oliver
        [biologist and programmer ]

        Comment

        Latest Articles

        Collapse

        • SEQadmin2
          Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
          by SEQadmin2



          CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

          Despite this, “CRISPR helped turn genome editing from a specialized technique into
          ...
          07-31-2026, 11:01 AM
        • SEQadmin2
          Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
          by SEQadmin2


          Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

          The systematic characterization of the human proteome has
          ...
          07-20-2026, 11:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by SEQadmin2, Today, 10:35 AM
        0 responses
        2 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-06-2026, 07:41 AM
        0 responses
        23 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 08-03-2026, 10:13 AM
        0 responses
        40 views
        0 reactions
        Last Post SEQadmin2  
        Started by SEQadmin2, 07-31-2026, 02:55 AM
        0 responses
        46 views
        0 reactions
        Last Post SEQadmin2  
        Working...