Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • frankyue50
    Member
    • Nov 2008
    • 34

    help with sam files

    Can someone help me with this rna-seq file:

    SOLEXA1_0001:1:90:12539:8935#0 16 chr1 3003182 3 8M1708N28M * 0 0 CCCCCATACCCACCCCCCAATCCCCTACCCACCCAC BCCCCB>6@@@<CCCCCCCB>AAAA=0BCC=CCCBC NM:i:2 XS:A:- NS:i:2

    What does NS mean? I couldn't find it in sam document. Thanks.
  • mrawlins
    Member
    • Apr 2010
    • 63

    #2
    NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

    NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
    Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.

    Comment

    • frankyue50
      Member
      • Nov 2008
      • 34

      #3
      Thanks. The rna-seq data was processed by tophat. I think the line in my example is a junction. what do you guys think?

      Originally posted by mrawlins View Post
      NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

      NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
      Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.

      Comment

      • john_mu
        Member
        • May 2010
        • 88

        #4
        EDIT: has been answered
        SpliceMap: De novo detection of splice junctions from RNA-seq
        Download SpliceMap Comment here

        Comment

        • mrawlins
          Member
          • Apr 2010
          • 63

          #5
          Ah, well, if it's tophat it's pretty easy to look it up in the code.
          Mismatches within min_anchor_len of a splice junction
          (from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

          It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.
          Last edited by mrawlins; 08-19-2010, 12:21 PM. Reason: Added code reference

          Comment

          • frankyue50
            Member
            • Nov 2008
            • 34

            #6
            Hi, mrawlins, you are the best! Thanks!

            Originally posted by mrawlins View Post
            Ah, well, if it's tophat it's pretty easy to look it up in the code.

            (from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

            It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.

            Comment

            Latest Articles

            Collapse

            • SEQadmin2
              Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
              by SEQadmin2



              Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
              ...
              07-09-2026, 11:10 AM
            • SEQadmin2
              Cancer Drug Resistance: The Lingering Barrier to Rising Survival
              by SEQadmin2



              Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

              There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
              07-08-2026, 05:17 AM
            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, 07-13-2026, 10:26 AM
            0 responses
            23 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-09-2026, 10:04 AM
            0 responses
            33 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-08-2026, 10:08 AM
            0 responses
            20 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 07-07-2026, 11:05 AM
            0 responses
            34 views
            0 reactions
            Last Post SEQadmin2  
            Working...