Hi Heng Li, I tried to align 50-bp Illumina Short Reads to RefSeq RNA. Because I expected that some reads will be mapped to multiple transcripts from the same gene, I used the -N parameter to gather all possible mappings. My command is as following:
bwa aln -N -l 32 -t 4 Indexed_RefSeq FASTQ > xxx.sai
However, when I exam the output sam files, I found the following example, where the MAPQ=0, and CIGAR = 50M. My experience is this means that the read mapped to multiple locations. So the -N was not activiated? Please HELP? Thank you!!!
HWI-EAS217:1:1:222:1093#0 16 gi|57863262|ref|NM_198393.2| 4097 0 50M * 0 0 CCATCTCAGGAGCTACTTGATGACATTGAGCTCTTGAAACAGCAGCAGGG [_N]Nbab_aaa[aa]babaaabaababaabaaabaabaaabaaa XT:A:R NM:i:0 X0:i :2 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
bwa aln -N -l 32 -t 4 Indexed_RefSeq FASTQ > xxx.sai
However, when I exam the output sam files, I found the following example, where the MAPQ=0, and CIGAR = 50M. My experience is this means that the read mapped to multiple locations. So the -N was not activiated? Please HELP? Thank you!!!
HWI-EAS217:1:1:222:1093#0 16 gi|57863262|ref|NM_198393.2| 4097 0 50M * 0 0 CCATCTCAGGAGCTACTTGATGACATTGAGCTCTTGAAACAGCAGCAGGG [_N]Nbab_aaa[aa]babaaabaababaabaaabaabaaabaaa XT:A:R NM:i:0 X0:i :2 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:50
Comment