Script to validate read identity

[joseangelivan]

Hi Pals

I have a file result from local blastn i need to validate the identity for each read then what i do is take the read ID (M03178:6:000000000-AD15M:1:1103:20724:12264) present in this file, go for it sequence in the original fastq file (ACTATGTTGGGCCTGGCAATGAGCTACAAGCTGGGCCCCCGCAAAGTGCTGTGGACAGTGCTGCAAGGATTCATGACTTTAGGTATAGCCAACTGGCTAAGTTGGGAATAAATCCATATACTCATTGGACTGTAGCAGATGAAGAGCTTTTAAAAAATATAAAAAATGAAACTGGGTTTTAAGCACAAGTAGTAAAAGACTACTTTACTTTAAAAGGTGCAGCTGCCCCTGTGGCCCATTTTCAAGGAAGT) and finally copy and paste it in web blastn. Could someone help me to write a script to make this to all reads on local blast file?

Regards

[GenoMax]

You already have a blast search result from which you want to fish out a sequence ID and then use that to get the original sequence and then paste that sequence into web blastn.

If I got that above right then that is not making logical sense. What are you trying to do? Confirm that the local blastn result will be the same as obtained from web blastn?

[joseangelivan]

If I got that above right then that is not making logical sense. What are you trying to do? Confirm that the local blastn result will be the same as obtained from web blastn?

Hi GenoMax tks for reply, thats exactly what i want confirm the local blast result with the web blast

Tks

[GenoMax]

Can I ask why you want to do this?

It will be simple to convert your original fastq file into fasta format and you could use that directly in web blastn. BTW: If by web blastn you mean the one @NCBI then that is going to limit you to a certain number of sequences (I don't know what the limit is). Then based on the database you are going to select/parameters the result could be different from what you have.