Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • How do I remove a part of the header of a fasta file in perl?

    I did a script in Perl that breaks several sequences of a multifasta file, but I need remove a part of string of header.

    For example:

    input file:
    >gi|983431797|ref|NZ_LN868938.1| Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT

    Output file:
    >Nocardia farcinica genome assembly NCTC11134, chromosome : 1
    CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
    CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT

    I've done everything, but I can't think of a solution to this.
    Can someone help me?

    My script:

    #!/usr/bin/perl

    use strict;
    use warnings;
    use IO::File;

    my $file = "\nFILE: perl $0 <Fasta>"."\n";
    print $file and exit unless($ARGV[0]);
    my $input = IO::File->new("$ARGV[0]"), my $output;
    while(my $line = $input->getline){
    chomp($line);
    if($line =~ /^>/){
    $line =~ s/^>//;
    $output = IO::File->new("> $line.fa");
    print $output ">".$line."\n";
    }else{
    print $output $line."\n";
    }
    }
    close($input);
    close($output);

  • #2
    Can you just split on " " and print the second element of the split array? Or split on '|' and take the last element. It just depends on how standard the formatting is of the header.
    @header_split = split(" ",$line);
    $changed_line = $header_split[1];
    Providing nextRAD genotyping and PacBio sequencing services. http://snpsaurus.com

    Comment


    • #3
      Originally posted by Katty1 View Post
      I did a script in Perl that breaks several sequences of a multifasta file, but I need remove a part of string of header.

      For example:

      input file:
      Code:
      >gi|983431797|ref|NZ_LN868938.1| Nocardia farcinica genome assembly NCTC11134, chromosome : 1
      CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
      CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT
      Output file:
      Code:
      >Nocardia farcinica genome assembly NCTC11134, chromosome : 1
      CTGACTGGGAGTACGAAGGCCGCCTGCACAAGACAACGGGGCAGCGAACCTTCTTCTGCACCGGCACGGA
      CGACGCCGAGATGCCTCGACCTGGAGAACCTCGGCCGCGGCGAACCGCTCGCCCATGTCCGCGCCGAGTT
      Katty,

      I would caution you that what you plan to do is potentially problematic. The generally accepted format for FASTA file deflines is that the first word after the ">" represents the unique identifier for the sequence. The "first word" is defined as everything up to the first "whitespace" which may be a space or tab character. Everything that comes after that is optional description text. If you also have included in your analysis:

      Code:
      >gi|873551602|emb|LN868939.1| Nocardia farcinica genome assembly NCTC11134, plasmid : 2
      GGCTTTGTGCCCGCCGAAAAAAGGTTGCCTATGTCCAAGCCTGCATTTACCGAAATCGACCGAATGACGG
      GCGGAGGGCGGAGTAATCGCACCCGCCCACCGGTCAACTTCCTTCTTCACACCGAGGAAGGAAACTCGAG...
      Which you also edit to:

      Code:
      >Nocardia farcinica genome assembly NCTC11134, plasmid : 2
      GGCTTTGTGCCCGCCGAAAAAAGGTTGCCTATGTCCAAGCCTGCATTTACCGAAATCGACCGAATGACGG
      GCGGAGGGCGGAGTAATCGCACCCGCCCACCGGTCAACTTCCTTCTTCACACCGAGGAAGGAAACTCGAG...
      You have two sequences as part of your analysis which share the same ID, "Nocardia".

      Comment


      • #4
        One alternative would be to change all spaces to "_" so that you have a long string (that should stay unique) for each fasta header. It would be cumbersome but would at least avoid the problem @kmcarr pointed out.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM
        • seqadmin
          Recent Advances in Sequencing Analysis Tools
          by seqadmin


          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
          05-06-2024, 07:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, 05-24-2024, 07:15 AM
        0 responses
        16 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 10:28 AM
        0 responses
        18 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 07:35 AM
        0 responses
        22 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-22-2024, 02:06 PM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Working...
        X